[صفحه اصلی ]   [Archive] [ English ]  
:: صفحه اصلي :: درباره نشريه :: آخرين شماره :: تمام شماره‌ها :: ثبت نام :: ارسال مقاله :: جستجو :: تماس با ما ::
:: دوره 12، شماره 12 - ( اسفند 1397 ) ::
جلد 12 شماره 12 صفحات 1-13 برگشت به فهرست نسخه ها
ارتباط پلی‌مورفیسم MMP-9 -1562 C>T و خطر سرطان مثانه
مرسده رحمانی مورچه خوری1 ، فرزانه تفویضی* 2، کوشا کمالی3
1- گروه زیست‌شناسی، واحد پرند، دانشگاه آزاد اسلامی
2- گروه زیست‌شناسی، واحد پرند، دانشگاه آزاد اسلامی ، farzanehtafvizi54@gmail.com
3- گروه آموزشی اورولوژی، بیمارستان هاشمی‌نژاد، دانشگاه علوم پزشکی ایران
واژه‌های کلیدی: سرطان مثانه، پلی مورفیسم، ژنتیک، ماتریکس متالوپروتئیناز
متن کامل [PDF 1093 kb]   (310 دریافت)     |   چکیده (HTML)  (1102 مشاهده)
نوع مطالعه: مقاله پژوهشي | موضوع مقاله: ژنتیک
دریافت: ۱۳۹۷/۶/۲۴ | پذیرش: ۱۳۹۷/۹/۲۰ | انتشار: ۱۳۹۸/۲/۱۸
* نشانی نویسنده مسئول: گروه زیست شناسی، واحد پرند، دانشگاه آزاد اسلامی، پرند، ایران
متن کامل:   (231 مشاهده)
مقدمه
سرطان مثانه (BC)، یازدهمین سرطان شایع از نظر بروز بیماری و چهاردهمین سرطانی است که منجر به مرگ می‌شود (1). میزان بروز و مرگ‌و‌میر این سرطان به‌طور عمده به‌علت تغییر در ریسک فاکتورها در سراسر جهان متفاوت است؛ به‌طوری‌که بیشترین میزان بروز آن از مصر، اروپا و آمریکای شمالی و شمال آفریقا گزارش شده است (2)، و کشورهای آسیایی، پایین‌ترین میزان بروز را داشته‌اند (3). همچنین این سرطان دومین تومور دستگاه مجاری ادراری - تناسلی بعد از سرطان پروستات است (4)، که شیوع آن در مردان سه برابر زنان بوده و در سفیدپوستان نیز شایع‌تر است. از مهم‌ترین ریسک فاکتورهایی مرتبط با سرطان مثانه، می‌توان به مصرف سیگار و مواجهه شغلی با کارسینوژن‌های اوروتلیال اشاره کرد. مصرف سیگار، 4-2 برابر ریسک سرطان مثانه را افزایش می‌دهد (5). یکی از مهم‌ترین رویدادها در بدخیمی سرطان‌ها؛ مهاجرت، جای‌گیری و رشد سـلول نئوپلاسـت به داخل بافت میزبان است. این فرآیند مستلزم مراحل پیچیده واکنش‌های سلول سرطانی با بافت میزبان و تغییرات ماتریکس خارج سلولی است و تاکنون آنزیم‌های مختلفی در رابطه با آن شناخته شده‌اند که در هضم ماتریکس خارج سولی مانند سرین پروتئازها (6،7)، ماتریکس متالومتالوپروتئینازها (8) و متالوپروتئینازهای تجزیه‌کننده ایفای نقش می‌کنند (9). متاستاز طی چندین مرحله شامل: جدا شدن سلول‌های بنیادی سرطانی از تومور اولیه، تخریب غشای پایه و ماتریکس خارج سلولی، داخل شدن به رگ‌ها، انتقال از طریق سیستم رگی و خارج شدن از عروق و در نهایت، ایجاد تومور ثانویه در بستر جدید انجام می‌گیرد. در این مراحل، برای اینکه تومور بتواند به اندازه بیش از 2 میلی‌متر مکعب رشد کند، باید توانایی رگ‌زایی داشته باشد (10)؛ بنابراین متاستاز و توانایی رگ‌زایی، دو فرآیند ضروری برای پیشرفت سرطان بوده که به‌وسیله بیان ژن‌های مختلفی ازجمله ماتریکس متالوپروتئینازها MMPs)) انجام می‌گیرند. ماتریکس متالوپروتئینازها، خانواده‌ای از آنزیم‌های دارای فعالیت پروتئولیتیکی هستند که در هضم اتصالات خارج سلولی و بافت پایه نگهدارنده سلول‌ها ایفای نقش می‌کنند و از این لحاظ می‌توانند بر عملکرد سلول‌ها در مراحل سرطانی‌شدن و تسریع این مراحل تأثیرگذار باشند (11). تحقیقات نشان می‌دهند این خانواده آنزیمی نه تنها در تغییرات فیزیکی بافت غشای پایه و اتصالات خارج سلولی نقش دارند؛ بلکه در شرایط پاتولوژیک شامل: پیشرفت، رشد تومورها، متاستاز و بدخیمی بسیاری از سرطان نیز مؤثرند (15-12). ماتریکس متالوپروتئینازها به گروه‌های مختلفی شامل:MMP های کلاسیک، MMPهای متصل به غشا،ADAMs  وADAMTs  تقسیم می‌شوند (16). یکی از اعضای مهم ماتریکس متالوپروتئینازهای کلاسیک، ژن ماتریکس متالوپروتئیناز - 9 می‌باشد که بر روی کروموزوم 20 قرار دارد و پروتئین 92 کیلودالتونی به‌نام کلاژناز یا ژلاتینازB  را رمزدهی می‌کند. این پروتئین قادر است کلاژن، پروتئوگلیکان‌ها، الاستین، فیبرونکتین، همچنین پروتئین‌های غیرماتریکسی نظیر  TNF-𝛼،TGF-𝛽،IL-8  را تجزیه کند .براساس نتایج  مطالعات، بیان ماتریکس متالوپروتئیناز - 9 درانواع بدخیمی‌ها افزایش می‌یابد که می‌تواند عواقب ناخوشایندی در پی داشته باشد، از جمله با آزادسازی بیش از حد فاکتورهای رشد و فاکتورهای رگ‌زایی می‌تواند به تکثیر سلول‌های سرطانی و رگ‌زایی تومور کمک کرده و با تخریب ماتریکس خارج سلولی و غشای پایه، فضای کافی برای رگ‌زایی یا مهاجرت سلولی را ایجاد ‌کند (17،18). برخی پلی‌مورفیسم‌های تک‌نوکلئوتیدی ژن ماتریکس متالوپروتئیناز 9 نیز در افزایش بیان آن مؤثر شناخته شده‌اند. یکی از این پلی‌مورفیسم‌ها به‌عنوان جایگزین تیمیدین به جای سیتوزین در ناحیه 1562- راه‌انداز ذکر شده است. این جایگزینی با کاهش قدرت اتصال پروتئین‌های سرکوبگر به ناحیه تنظیمی  AP-1باعث افزایش 5/1 برابری رونویسی از ژن ماتریکس متالوپروتئیناز - 9 می‌شود؛ در نتیجه میزان بیان کلی این آنزیم در افراد دارای آلل T افزایش می‌یابد، ولی در افراد واجد نوکلئوتید  C (سیتوزین) در این پلی‌مورفیسم، پــروتئین‌های مهارکننده رونویسی به پروموتر ژن متصل و بیان کلی ماتریکس متالوپروتئیناز - 9  کاهش می‌یابد (19). همچنین ماتریکس متالوپروتئیناز - 9، تنها عضوی است که قابلیت هضم ژلاتین (یکی از مهم‌ترین ترکیبات بافت غشای پایه) را دارد و تاکنون به‌عنوان یک مارکر سرطانی امیدبخش برای بررسی وضعیت بیماران و پیشگیری از چندین سرطان شناخته شده است (20).
در این مطالعه، ارتباط بین پلی‌مورفیسم پروموتر ژن MMP-9 (-1562 C>T) و احتمال خطر ابتلا به سرطان مثانه، فرکانس اللی و شیوع ژنوتیپ‌ها و معرفی الل پرخطر مورد بررسی قرارگرفت.
 
روش بررسی
در این مطالعه مورد - شاهدی، نمونه خون 141 فرد مبتلا به سرطان مثانه (بازه سنی 62/13±89/60 سال) و 135 فرد سالم (بازه سنی 41/16±40/60 سال) از میان افراد مراجعه‌کننده به بیمارستان جهت چکاپ سالیانه که هیچ‌گونه بیماری خاص و سرطان نداشتند، به‌عنوان کنترل بررسی گردید. پس از هماهنگی‌های لازم با همکاری کارکنان و پزشکان اطاق عمل هاشمی‌نژاد، همچنین گرفتن رضایت‌نامه کتبی از افراد، نمونه‌ها در فاصله زمانی تیرماه 1393 تا مرداد 1395 جمع‌آوری شدند. پس از نمونه‌گیری از هر فرد، جداسازی خون از سرم صورت‌گرفت و تا تکمیل شدن نمونه‌ها در فریز 20- درجه نگهداری شد.
ابتدا کل  DNAسلولی برطبق دستورالعمل کیت استخراج DNA از خون (شرکت زیست دانش یاران) استخراج گردید، سپس 300 میکرولیتر از نمونه خون مورد بررسی، درون میکروتیوب 5/1 سی‌سی ریخته شد و با بافر لیزکننده گلبول‌های قرمز خون (RBC lysis solution 1) و 50 ماکرولیتر از بافر (RBC lysis solution 2 ) مخلوط شد و به مدت 10 دقیقه در دمای 37 درجه سانتیگراد انکوبه گردید. پس از انکوباسیون، در rpm12000 به مدت 2 دقیقه سانتریفوژ شد، سپس فاز رویی دور ریخته شد. این مرحله سه بار تکرار گردید تا یک پلیت سفیدرنگ در انتهای میکروتیوب باقی بماند. به میکروتیوب، 300 میکرولیتر از بافر 1Cell Lysis Solution  و 40 میکرولیتر از بافر 2Cell Lysis Solution  اضافه شد و به مدت 10 دقیقه در دمای 37 درجه سانتیگراد انکوبه گردید، سپس 100 میکرولیتر از بافر 3Cell Lysis Solution  به مخلوط اضافه و نمونه‌ها در rpm 12000 به مدت 2 دقیقه سانتریفوژ شدند و فاز رویی به میکروتیوب‌های جدید منتقل گردید. با استفاده از ایزوپروپانل، رسوب DNA جدا گردید، سپس با الکل 80% شست‌وشو داده شد. رسوب DNA در دمای 37 درجه سانتیگراد خشک و در بافرDNA hydration  حل گردید و تا زمان استفاده در فریزر 20- درجه نگهداری شد.
برای بررسی کیفیت DNAهای استخراج‌شده با دو روش، از ژل آگارز 1% رنگ‌آمیزی‌شده با DNA Safe Stain (خریداری‌شده از شرکت سیناژن) استفاده شد. جهت تعیین کمّیت و کیفیت DNA استخراج‌شده از نانودراپNano Drop ND-1000 ، با اندازه‌گیری میزان جذب نوری 230/260 و 280/260 نانومتر غلظت DNA، خلوص و آلودگی پروتئینی DNA استخراج‌شده تعیین گردید.
 واکنش PCR در حجم نهایی 25 میکرولیتر شامل: 5/2 میکرولیتر بافر آمپلیکون، 5/0 میکرولیتر (4/0 میکرومولار) از پرایمر اختصاصی ژن MMP-9 با توالی‌های پرایمر پیشرو 5 '- GCCTGGCACATAGTAGGCCC -3' و پرایمر پیرو 5'- CTTCCTAGCCAGCCGGCATC -3´ تهیه‌شده از شرکت تکاپوزیست، 50 نانوگرم از DNA نمونه‌های استخراج‌شده و تا حجم 25 میکرولیتر آب مقطر استریل‌شده بود.
تکثیر DNA با استفاده از دستگاه ترموسایکلر (Bio Rad PCR System,USA) مطابق برنامه دمایی شامل: مرحله دناتوراسیون ابتدایی در 95 درجه به مدت 3 دقیقه، 35 چرخه اتصال پرایمر با اعمال دمای 95 درجه سانتیگراد به مدت 30 ثانیه، دمای 64 درجه سانتیگراد به مدت 40 ثانیه و دمای 72 درجه به مدت 1 دقیقه صورت گرفت. در پایان، مرحله گسترش نهایی پرایمر با اعمال دمای 72 درجه به مدت 5 دقیقه انجام شد. محصولاتPCR  پس از رنگ‌آمیزی با Safe DNA Stain  بر روی ژل آگارز 2% در تانک الکتروفورز حاوی بافر TBE با ولتاژ 100ولت به مدت یک ساعت مورد بررسی کیفی قرار گرفت که نتایج به‌وسیله دستگاه ژل‌داک و با اشعه UV مشاهده گردید.
جهت بهینه‌سازی واکنش RFLP، 10 میکروگرم DNA، 2 میکرولیتر بافرX TangoTM 10 و 1 میکرولیتر آنزیم محدودالاثرsph1 (Fermentase) و 6 میکرولیتر از PCR product در نظر گرفته شد. نمونه‌ها به مدت 16 ساعت در انکوباتور 37 درجه سانتیگراد برای تأثیر آنزیم محدودکنندهSph1  و 20 دقیقه در انکوباتور 65 درجه سانتیگراد برای غیرفعال کردن آنزیم قرار گرفتند. (آلل هموزیگوت C توسط یک باند 442 جفت باز مشخص می‌گردد؛ درحالی‌که آلل T هموزیگوت با دو باندbp  264 و 178 و هتروزیگوت با سه باند 442، 264، 178 جفت باز متمایز می‌شوند.) درپایان، 10 میکرولیتر از محصول واکنش RFLP به همراه X Loading dye6 روی ژل آگارز 3% در کنار 2 میکرولیتر مارکرbp 100 الکتروفورز شد.
ارتباط بین پلی‌مورفیسم C>T 1562-MMP-9  خطر ابتلا به سرطان مثانه و خصوصیات پاتولوژیک با استفاده از آزمون کای اسکوئر و نرم‌افزار 01/6 Graphpad prism انجام شد. سطح اطمینان CI (Confidence Interval) وOR (Odds Ratio)  مورد محاسبه قرار گرفت. تعادل هاردی واینبرگ با استفاده از نرم‌افزار 32/1 POPGENE Ver  محاسبه گردید. در تمامی محاسبات سطح معنی‌داری، 05/0p< در نظر گرفته شد.
 
یافته‌ها
مشخصات بالینی و کلینیکوپاتولوژیک نمونه‌های مورد مطالعه در جدول شماره 1 خلاصه شده است.
 
جدول شماره 1: مشخصات بالینی و کلینیکوپاتولوژیک
مشخصات بیماران تعداد نمونه‌ها
گروه‌ها ) n=135) گروه کنترل  )n=141) گروه بیمار
تعداد (درصد)  تعداد (درصد)
سن کوچکتر از 50 سال (1/31%) 42 (60/15%) 22
بزرگتر مساوی 50 سال (9/68%) 93 (04/84%) 119
جنسیت
 
مرد (7/86%) 117 (83%) 117
زن (30/13%) 18 (17%) 24
مصرف دخانیات
 
بله (40/27%) 37 (16/58%) 82
خیر (60/72%) 98 (84/41%) 59
 
استیج تومور Ta   (28/60%) 85
T1
 
  (50/30%) 43
T2   (51/8%) 12
T3
 
  (71/0%) 1
گرید تومور Low   (80/46%) 66
High   (20/53%) 75
 
پس از انجام واکنش PCR، محصول واکنش روی ژل آگارز 2% برده شد و طول قطعه با طراحی پرایمر مورد نظر بررسی گردید. در مورد پلی‌مورفیسمC>T 1562- در ژن ماتریکس متالوپروتئیناز - 9، طول قطعه مورد نظر 442 جفت باز می‌باشد.
نتایج حاصل از آنالیز داده‌های به‌دست‌آمده از روش RFLP برای نمونه‌های بیمار و سالم در شکل شماره 1 آمده است.
 
1
شکل شماره 1: ژنوتیپCC  با قطعه 442 جفت بازی، ژنوتیپ TT توسط دو باند 264 و 178 جفت بازی و هتروزیگوت‌های CT با سه باند 442، 264، 178 جفت بازی متمایز شده‌اند.
 
براساس آنالیزهای آماری، میانگین سنی در دو گروه کنترل و بیمار بررسی گردید. 119 نفر از گروه بیمار و 93 نفر از افراد گروه کنترل، بالای 50 سال سن داشتند و 22 بیمار و 42 فرد سالم، زیر 50 سال بودند. بین افزایش سن و خطر ابتلا به سرطان مثانه، رابطه معنی‌داری دیده شد
 ]002/0p=،(37/4-36/1 CI ( 95%، 44/2.[OR:  ریسک 5/2 برابری ابتلا به سرطان با افزایش سن مشاهده گردید.
مصرف دخانیات به‌عنوان عامل خطری در بروز سرطان مثانه در دو گروه بیمار و کنترل مورد بررسی قرار گرفت. 82 نفر از افراد مبتلا به سرطان و 37 نفر از افراد کنترل، دخانیات مصرف کرده بودند. ارتباط معنی‌داری بین مصرف دخانیات و احتمال بروز سرطان مثانه مشاهده گردید ]0001/0p= و (96/5- 16/2 CI (95%، 59/3[OR:. با توجه به میزان عددی OR، مصرف دخانیات به میزان 5/3 برابر خطر ابتلا به سرطان مثانه را افزایش می‌دهد.
فرکانس ژنی و ژنوتیپی برای هر دو جمعیت بیمار و سالم محاسبه گردید. الل C در هر دو جمعیت بیمار، 28/71% و جمعیت کنترل، 15/68% بیشترین میزان را به خود اختصاص داد. دو جمعیت سالم و بیمار مورد بررسی در حال تعادل بودندو با اینکه الل C فراوانی بیشتری در جمعیت مورد بررسی داشت، ولی اختلاف معنی‌داری در فرکانس اللی مشاهده نشد (42/0p=)(جدول شماره 2).
 
جدول شماره 2: فرکانس ژنی، ژنوتیپی و تعادل هاردی وینبرگ در جمعیت‌های سالم و بیمار
 بیمار(درصد)
n=141
pvalue تعادل هاردی واینبرگ گروه بیمار (HWE) کنترل(درصد)
n= 135
pvalue تعادل هاردی واینبرگ گروه کنترل
  1. (68/44)
  1.  35/12)
  1. (17/36)
  1. 15/21)
  1. (2/53)
 
  1. (15/58)
 
  1. (12/3)
 
  1. (41/1)
 
 
اصطلاح HWE Hardy-Weinberg equilibrium : HWE؛
سطح معنی‌داری، 05/0*=p<؛
a مقایسه بین گروه بیمار و کنترل.
 
در این مطالعه، ارتباطی بین ژنوتیپ‌ها و خطر ابتلا به سرطان مثانه دیده نشد. همچنین بین ترکیب ژنوتیپ‌های مورد مطالعه و خطر ابتلا به سرطان مثانه، ارتباطی وجود نداشت (جدول شماره 3(.
 
جدول شماره 3: ارتباط ژنوتیپ‌ها با خطر ابتلا به سرطان مثانه
 
گروه
ژنوتیپ
بیمار
n=141
کنترل
n=135
OR (%95CI) pvalue
63 51 1 (Reference) -
75 82 74/0 (46/02/1) 22/0
3 2 21/1 (19/055/7) 83/0
ترکیب زنوتیپ‌ها      
63 51 1 (Reference) 24/0
78 84 75/0 (46/021/1)
3 2 1 (Reference) 69/0
138 133 69/0 (11/02/4)
الل
C 201 184 1 (Reference) pvalue
T 81 86 86/0 (60/024/1) 42/0
 
همچنین ارتباط معنی‌داری بین ژنوتیپ‌ها با مصرف سیگار، گرید بیماری، مرحله بیماری و اندازه تومور دیده نشد (05/0(p˃. نتایج به تفکیک در جدول شماره 4 آمده است.
 
جدول شماره 4: بررسی ارتباط ژنوتیپ‌ها با مصرف سیگار، گرید بیماری ، مرحله بیماری و اندازه تومور
وضعیت سیگار
غیرسیگاری
گروه
ژنوتیپ‌ها
بیمار
)n=59)  
کنترل
)n=98)  
OR (95% CI) p value
CC 27 37 1 (Reference) -
CT 31 59 72/0 (37/039/1) 32/0
TT 1 2 68/0 (06/095/7) 76/0
ترکیب ژنوتیپ‌ها
CC 27 37 1 (Reference) 28/0
CT+TT 31 61 69/0 (36/034/1)
TT 1 2 1 (Reference) 87/0
CT+CC 58 96 21/1 (10/063/13)
سیگاری
گروه
ژنوتیپ‌ها
بیمار
)n=82)  
کنترل
)n=37)  
OR (95% CI) pvalue
CC 36 14 1 (Reference) -
CT 44 23 74/0 (33/065/1) 46/0
TT 2 0 98/1 (09/098/43) 38/0
ترکیب ژنوتیپ‌ها
CC 36 14 1 (Reference) 53/0
CT + TT 46 23 77/0 (35/072/1)
TT 2 0 1 (Reference) 33/0
CT+CC 80 37 43/0 (02/017/9)
CC 36 14 1 (Reference) 53/0
سایز تومور
ژنوتیپ‌ها  سایز تومور<3cm
 )n=75)
سایز تومور3 cm,)n=65)   OR (95% CI) pvalue
CC 32 31 1(Reference) -
CT 42 33 81/0 (41/058/1) 54/0
TT 1 2 06/2 (17/096/23) 55/0
ترکیب ژنوتیپ‌ها
CC 32 31 1(Reference) 60/0
CT+TT 43 35 84/0 (43/063/1)
TT 1 2 1(Reference) 48/0
CT+CC 74 64 43/0 (03/088/4)
گرید بیماری
ژنوتیپ‌ها Low
)n=66)  
High
)n=75)  
OR (95% CI) pvalue
CC 27 36 1(Reference) -
CT 38 37 73/0 (37/043/1) 36/0
TT 1 2 5/1 (13/04/17) 74/0
ترکیب ژنوتیپ‌ها
CC 27 36 1(Reference) 39/0
CT+TT 39 39 75/0 (38/046/1)
TT 1 2 1(Reference) 63/0
CT+CC 65 73 56/0 (05/034/6)
استیج بیماری
Ta and T1
(n = 128)
T2 and T3
(n = 14)
OR (95% CI) pvalue
CC 57 6 1(Reference) -
CT 68 7 97/0 (31/007/3) 97/0
TT 3 0 26/1 (06/03/27) 57/0
ترکیب ژنوتیپ‌ها
CC 57 6 1(Reference) 91/0
CT+TT 71 7 93/0 (29/094/2)
TT 3 0 1(Reference) 57/0
CT+CC 125 13 75/0 (03/038/15)
 
در افراد سیگاری، 44 نفردارای گرید بالا و 36 نفر گرید پایین و در افراد غیرسیگاری به ترتیب 31 نفر گرید بالا و 30 نفر دارای گرید پایین بودند. ولی بین مصرف سیگار با گرید بیماری، ارتباط معنی‌داری یافت نشد (05/0) (جدول شماره 5).
تومورها در دو گروه سیگاری و غیرسیگاری تقسیم شدند (جدول شماره 5). در افراد سیگاری، 41 نفر دارای اندازه تومور 3 سانتی‌متر و بیش از آن و در 39 نفر کوچکتر از 3 سانتی‌متر بود. افراد غیرسیگاری، 25 نفر با اندازه تومور 3 سانتی‌متر و بیش از آن و 36 نفر اندازه تومور کوچکتر از 3 سانتی‌متر داشتند. بین ژنوتیپ‌ها و اندازه تومور ارتباط معنی‌داری دیده نشد (05/0). همچنین بین مصرف سیگار و استیج بیماری، رابطه معنی‌داری مشاهده نگردید (05/0).
 
 
 
 
 
 
جدول شماره 5: بررسی ارتباط بین مصرف سیگار، گرید بیماری، مرحله بیماری و سایز تومور در بیماران مبتلا به سرطان مثانه
گرید سرطان گرید پایین گرید بالا OR (%95CI)
  1. value
30 نفر 31 نفر 1 (Reference)
36 نفر 44 نفر 18/1 (60/03/2)
سایز تومور سایز تومور<3cm سایز تومور3cm OR (%95CI)
  1. value
36 نفر 25 نفر 1(Reference)
39 نفر 41 نفر 51/1 (77/097/2)
 
بحث
ماتریکس متالوپروتئینازها(MMPs) ، یک خانواده پروتئیناز وابسته به روی هستند که قابلیت تخریب تمامی زیرساختارهای ماتریکس خارج سلولی و تنظیم رفتارهای مختلف سلولی را دارند (21)، که از این طریق در رخدادهای فیزیولوژیک؛ ازجمله بازسازی بافت در حاملگی، بهبود زخم و آنژیوژنز (16) و وقایع پاتولوژیک مثل سرطان، نارسایی قلبی، آرتریت و پریودنتیت دخالت دارند (22). ماتریکس متالوپروتئینازها براساس ساختار و خصوصیات سوبستراهایشان به زیرگروه‌های مختلفی تقسیم می‌شوند. این زیرخانواده شامل: کلاژناز، ژلاتیناز، استرولیزین، ماترییلیزین،MMP های غشایی و سایر ماتریکس متالوپروتئینازها می‌باشند. یافته‌های علمی نشان می‌دهد ماتریکس متالوپروتئینازها نقش مهمی در مراحل مختلف پیشرفت و گسترش سرطان مانند تنظیم رشد سلول‌های سرطانی، تمایز، آپوپتوز، آنژیوژنز، تهاجم و متاستاز دارند. ماتریکس متالوپروتئینازها این کار را با تخریب ماتریکس خارج سلولی، موانع و سدهای غشایی انجام می‌دهند (14،22). خانواده MMP شامل بیش از 25 پروتئیناز خارج‌سلولی است و این آنزیم‌ها در توسعه سرطان، تهاجم و پیشرفت تومور بسیار تأثیرگذار بوده و از لحاظ بالینی در تخریب اجزای مختلف ماتریکس خارج سلولی و غشای پایه نیز مهم می‌باشند (23،24).
MMP-1، MMP-2، MMP-3،MMP-7  و MMP-9 پنج عضو مهم خانواده ماتریکس متالوپروتئینازها هستند. MMP-9 که بر روی کروموزوم  20q11.2-q13.1 قرار دارند، به‌عنوان 92 kDa gelatinase B شناخته می‌شود و فعالیت پروتئولیتیک علیه کلاژن نوع IV را برعهده دارد که سبب تسهیل مهاجرت سلول‌های ماهیچه‌ای صاف عروقی نیز می‌گردد (25). در پلی‌مورفیسم ژنتیکی تک‌نوکلئوتیدی (3918242rs)1562-  MMP-9 ، نشان داده شده است جایگزینی C باT  سبب افزایش و تقویت فعالیت پروموتر می‌شود؛ بنابراین حضور آللT1562- با کاهش ظرفیت اتصال پروتئین سرکوبگر رونویسی به ناحیه پروموتور و متعاقب آن، افزایش بیان ژن و میزان رونویسی از پروموترهمراه است (26).
(Single Nucleotide Polymorphisms) SNPs، شایع‌ترین شکل تنوع ژنتیکی در ژنوم انسان است. برطبق قرارداد، زمانی از یک جهش نقطه‌ای تحت عنوان SNP یاد می‌شود که فراوانی آلل مینور (نادر) بیش از 1٪ در یک جمعیت باشد (27)؛ به‌عنوان مثال، وقوع SNP در یک منطقه تنظیم‌کننده ژن ممکن است بر روی رونویسی ژن تأثیر داشته باشد.SNP  واقع در جایگاه پیرایش RNA ممکن است بر روی پیرایش RNA نیز مؤثر باشد. SNP در منطقه' 3 غیرترجمه‌نشدنی یک ژن ممکن است بر ثبات mRNA تأثیر داشته وSNP  نیز در منطقه کدگذاری به جایگزینی اسید آمینه در پروتئین کد شده منجر گردد. تصور می‌شود SNPs  در تغییرپذیری افراد در حساسیت به بیماری‌های شایع مانند سرطان دخالت دارند (28). سرطان مثانه، یکی از شایع‌ترین بیماری‌های بدخیم ادراری در دنیا است (31-29). بیشتر سرطان‌های مثانه از نوع
 Transitional Cell Carcinoma و مابقی از نوع Squamous Tumors, Adenocarcinoma و ساب‌تایپ‌های دیگر هستند (32)، که معمولاً با افزایش سن بروز می‌کند و در مردان از شیوع بالاتری برخوردار است؛ با این حال، مکانیسم دخیل در بروز سرطان مثانه مشخص نیست (33). چندین عامل محیطی به‌عنوان ریسک فاکتور برای سرطان مثانه معرفی شده‌اند که می‌توان به مصرف دخانیات، التهابات مزمن، آمین‌های آروماتیک موجود در رنگ‌ها، تشعشعات و غیره اشاره کرد (34،35)؛ با این حال، افراد زیادی با اینکه در معرض این ریزفاکتورها نیستند، دچار ابتلا به سرطان مثانه شده و افرادی نیز که در معرض این ریسک فاکتورها قرار دارند، شواهدی از سرطان مثانه در آنها دیده نمی‌شود و به آن ابتلا نمی‌گردند (36،37). فاکتورهای میزبان همچون پلی‌مورفیسم‌های ژنتیکی به‌عنوان یکی از ریسک فاکتورهای مهم در پیشرفت و توسعه سرطان‌ها، ازجمله سرطان مثانه معرفی شده‌اند (40-38). شواهدی در مورد نقش مهم عوامل ژنتیکی در حساسیت میزبان به سرطان مثانه وجود دارد (43-41). MMP-9نقش مهمی در انواع سرطان‌ها دارد (44). Mutsumura و همکاران نشان دادند الل -1562 T با افزایش ریسک سرطان معده ارتباط دارد (45). همچنین واریانت‌های ژن MMP-9 با ریسک متاستاز در سرطان ریه، ملانوما و گریدهای بالا در Renal Cell Carcinoma ارتباط دارند (48-46). در تحیقق حاضر، ارتباطی بین پلی‌مورفیسم پروموتر1562- MMP-9 و ریسک سرطان مثانه پیدا نشد. الل T شیوع بسیار پایینی در جمعیت مورد مطالعه داشت؛ به‌طوری‌که ژنوتیپ TT تقریباً در 2% جمعیت بیماران مورد مطالعه و 4/1% در جمعیت گروه کنترل یافت شد. ژنوتیپ CT با 60% و 53%، بیشترین فراوانی را به ترتیب در گروه کنترل و بیمار به خود اختصاص دادند و ارتباطی بین پلی‌مورفیسم ژنتیکی و گرید بیماری، سایز تومور، استیج بیماری و مصرف دخانیات مشاهده نشد که این یافته در مطالعه حاضر همسو با نتایج سایر تحقیقاتی است که در این زمینه صورت گرفته و تأییدکننده نتایج همین مطالعه می‌باشد که در ادامه به آن اشاره می‌شود.
Kader و همکاران نیز با روش PCR-RFLP تأیید کردند ارتباطی بین پلی‌مورفیسم پروموتر MMP-9 و حساسیت‌پذیری نسبت به سرطان مثانه وجود ندارد (49). و در یک مطالعه دیگر، ارتباطی بین پلی‌مورفیسم MMP-9 در Invasive Bladder Cancer  و Superficial Bladder Cancer مشاهده نشد (50). Wieczorek و همکاران در سال 2013، نشان دادند ارتباطی بین پلی‌مورفیسمMMP-9 -1562  و ریسک سرطان مثانه وجود ندارد. روش مورد مطالعه در این تحقیق، Taq man بود و بر روی نژاد Caucasian انجام شد. ولی در یک مطالعه ترکیب ژنوتیپی نشان داده شد مجموع ژنوتیپ در پلی‌مورفیسم‌های C/T 1306- MMP-2 با C/T 1562-  MMP-9 در الل T، خطر ابتلا به سرطان مثانه را افزایش می‌دهد (24). Yan و همکاران نیز سال 2014 در یک مطالعه متاآنالیز نشان دادند ارتباطی بین پلی‌مورفیسم MMP-9 و سرطان مثانه وجود ندارد (51). در مقاله متاآنالیز دیگری که در سال 2015 توسط Tao و همکاران منتشر شد، عدم ارتباط پلی‌مورفیسم پروموتر1562-MMP-9  و خطر ابتلا به سرطان مثانه به اثبات رسید (52).
 
نتیجه‌گیری
در تحقیق حاضر، عدم ارتباط پلی‌مورفیسم C/T1562-MMP-9  و ریسک سرطان مثانه دیده شد. احتمال دارد پلی‌مورفیسم‌های دیگری از ژن MMP-9 در تغییر میزان بیان آنزیم در بین ژنوتیپ‌ها و حساسیت‌پذیری نسبت به سرطان مثانه تأثیرگذار باشند. همچنین پلی‌مورفیسم‌های ناشناخته ممکن است بر ارتباط پلی‌مورفیسم MMP-9 و خطر سرطان مثانه اثر بگذارند؛ لذا مطالعات بیشتر در این زمینه به درک بیشتر در مورد بیولوژی بیماری و استراتژی درمان کمک خواهد کرد.
 
ارسال پیام به نویسنده مسئول

ارسال نظر درباره این مقاله
نام کاربری یا پست الکترونیک شما:

CAPTCHA



XML   English Abstract   Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Rahmani M, Tafvizi F, Kamali K. Association of Matrix metalloproteinases-9 -1562 C>T and susceptibility to bladder cancer. Qom Univ Med Sci J. 2019; 12 (12) :1-13
URL: http://journal.muq.ac.ir/article-1-2239-fa.html

رحمانی مورچه خوری مرسده، تفویضی فرزانه، کمالی کوشا. ارتباط پلی‌مورفیسم MMP-9 -1562 C>T و خطر سرطان مثانه. مجله دانشگاه علوم پزشکی قم. 1397; 12 (12) :1-13

URL: http://journal.muq.ac.ir/article-1-2239-fa.html



دوره 12، شماره 12 - ( اسفند 1397 ) برگشت به فهرست نسخه ها
مجله دانشگاه علوم پزشکی قم Qom University of Medical Sciences Journal
Persian site map - English site map - Created in 0.22 seconds with 32 queries by YEKTAWEB 3960