دوره 12، شماره 4 - ( تیر 1397 )                   جلد 12 شماره 4 صفحات 88-81 | برگشت به فهرست نسخه ها


XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Asgari A, Nazari R, Razavian S M H. Investigation of Frequency of Mycoplasma hominis and Biological Parameters in Semen Sample of Men Referred to Qom Jihad Daneshgahi Infertility Treatment Center in 2016 (Iran). Qom Univ Med Sci J 2018; 12 (4) :81-88
URL: http://journal.muq.ac.ir/article-1-1584-fa.html
عسگری علی، نظری راضیه، رضویان سید محمد حسین. بررسی فراوانی مایکوپلاسما هومینیس و مطالعه شاخص‌های بیولوژیک در مایع منی مردان نابارور مراجعه‌کننده به مرکز درمان ناباروری جهاد دانشگاهی قم، سال 1395. مجله دانشگاه علوم پزشکی قم. 1397; 12 (4) :81-88

URL: http://journal.muq.ac.ir/article-1-1584-fa.html


1- گروه میکروب‌شناسی، واحد قم، دانشگاه آزاد اسلامی، قم، ایران
2- گروه میکروب‌شناسی، واحد قم، دانشگاه آزاد اسلامی، قم، ایران ، nazari1102002@yahoo.com
متن کامل [PDF 413 kb]   (1063 دریافت)     |   چکیده (HTML)  (4542 مشاهده)
متن کامل:   (2880 مشاهده)
مقدمه
مایکوپلاسما‌ها، کوچکترین پروکاریوت‌هایی هستند که ویژگی شاخص آنها، فقدان دیواره سلولی است (1،2). مایکو‌پلاسماهای تناسلی به فراوانی در مجرای تناسلی و مایع منی هر دو گروه مردان (افراد با قدرت باروری و افراد فاقد قدرت باروری) یافت می‌شوند (3،4). مایکوپلاسما هومینیس به‌همراه کلامیدیا تراکوماتیس، جزء شایع‌ترین عوامل ایجاد‌کننده اورتریت غیرگونوکوکی بوده (1،2)، و در بیماری‌های التهابی لگن، واژنوز باکتریایی، تب پس از زایمان و تب پس از سقط نیز نقش دارند (2،5،6). مایکوپلاسما هومینیس یکی از مهم‌ترین مایکوپلاسماهایی است که از دستگاه تنفسی و ادراری - تناسلی جدا می‌‌شود. عفونت ناشی از این باکتری اغلب بی‌علامت بوده، اما تأثیراتی منفی بر سلامت دستگاه تناسلی مردان مانند تأثیر بر حجم، pH، تحرک، شکل، تعداد و قابلیت حیاتی اسپرم می‌گذارد. این باکتری با اتصال به سر، دُم و بخش میانی اسپرم‌ها جهت کسب آستروئیدهای مورد نظر خود سبب بی‌حرکت‌شدن آن‌ها و حتی نفوذ به داخل اسپرم می‌گردد، همچنین این باکتری با تولید یون‌های سوپراکسید و پراکسید هیدروژن موجب آسیب غشایی سلولی و با آزاد‌کردن آنزیم اوره‌آز باعث تولید آمونیاک و نابودی اسپرم‌ها می‌‌شود. در اثر سموم، آنزیم‌ها و یا اتصال باکتری به اسپرم و یا از طریق تحریک سیستم ایمنی علیه اسپرم، آسیب به تمام نواحی دستگاه تناسلی ادراری می‌تواند وارد شود که در نتیجه منجر به آسیب عملکرد اسپرم و تخریب آن، سپس تنگی مجاری سمینال می‌گردد. این باکتری با تولید نورآمینیداز، از مرحله لانه گزینی بلاستوسیت نیز ممانعت می‌کند. علاوه بر این، با تغییر pH ناحیه مهبل موجب سقط جنین، اختلال در خصوصیات فیزیولوژیک مایع مهبلی و نفوذپذیری اسپرم می‌شود. از آنجایی‌که کشت مایکوپلاسما دشوار بوده و هزینه بالایی نیز دارد؛ بنابراین روش PCR در تشخیص این باکتری به‌عنوان روشی حساس، سریع، آسان و کاملاً اختصاصی بسیار مورد توجه است (7). گلشنی و همکاران در تهران (سال 1386) با روش PCR به بررسی آلودگی مایکوپلاسما هومینیس در نمونه‌های مایع منی مردان نابارور پرداخته و میزان آلودگی با مایکوپلاسما هومینیس را 11% گزارش کردند (8). احمدی و همکاران در بررسی آلودگی مایکوپلاسما هومینیس نمونه‌های مایع منی مردان نابارور مراجعه‌کننده به پژوهشکده رویان با استفاده از روش PCR، میزان آلودگی را 5/15% اعلام کردند (2). گرچه عفونت ناشی از مایکوپلاسما هومینیس اغلب بی‌علامت است، اما تأثیرات منفی بر سلامت دستگاه تناسلی می‌گذارد؛ بنابراین تحقیق حاضر با هدف بررسی فراوانی مایکوپلاسما هومینیس و شاخص‌های بیولوژیک در نمونه‌های مایع منی مردان نابارور مراجعه‌کننده به مرکز درمان ناباروری جهاد دانشگاهی قم انجام شد.
 
روش بررسی
در این مطالعه توصیفی - تحلیلی، مقطعی، تعداد 187 نمونه مایع منی مردان نابارور مراجعه‌کننده به مرکز فوق‌تخصصی درمانی ناباروری جهاد دانشگاهی قم، انتخاب و بررسی شدند. حجم نمونه با توجه به درصد شیوع متوسط این باکتری (2) به روش زیر محاسبه گردید.
 n 4pq/d2 (4 0.02 0.08) (0.06)2≈178
در این فرمول: p فراوانی وجود باکتری (20%)؛
q فراوانی عدم وجود باکتری (80%)؛
d سطح دقت (دقت مطلوب جهت تعمیم نتایج نمونه به جامعه می‌باشد.) که 06/0در نظر گرفته شد.
در ابتدا اطلاعات مربوط به بیماران طی یک پرسشنامه به همراه رضایت‌نامه آنها گرد‌آوری شد، سپس نمونه‌های مایع منی در ظرف‌های مخصوص جمع‌آوری و برای هر نمونه در مرحله اول، تست اسپرموگرام (طبق دستورالعمل سازمان بهداشت جهانی در سال 2010) انجام گرفت (9). در بررسی شاخص‌های بیولوژیک در نمونه‌های مایع منی جمع‌آوری‌شده درآزمایش اسپرموگرام، شاخص‌هایی مانند حجم، تعداد، pH، شکل و حرکت اسپرم سنجیده شد (9). بررسی حرکت اسپرم براساس معیار سازمان بهداشت جهانی، در چهار کلاس (a، b، c، d) تقسیم‌بندی شده است (10). اسپرم‌ها در کلاس a حرکت مستقیم روبه جلو؛ در کلاس b حرکت مستقیم رو به جلو، نه مستقیم؛ در کلاس c حرکت درجا و در کلاس d فاقد حرکت و مرده می‌باشند (10).
برای ردیابی و شناسایی مایکوپلاسما هومینیس از نمونه‌های مایع منی جمع‌آوری‌شده، روش PCR به کار برده شد. برای این منظور ابتدا از مایع منی، DNA به روش فنل کلروفرم استخراج شد (11)، سپس نمونه‌های DNA استخراج‌شده در دمای 20- درجه سانتیگراد نگهداری شدند.
جهت شناسایی مایکوپلاسما هومینیس، از توالی‌های پرایمر اختصاصی مربوط به ژنSrRNA 16 استفاده گردید (جدول شماره 1) (12).
 
جدول شماره 1: توالی پرایمرهای اختصاصی ژ نSrRNA 16
ژن هدف پرایمر توالی پرایمر (3' 5') محصول (bp) PCR
334 F: CAATGGCTAATGCCGGATACGC RNA H1 16SrRNA
R: GGTACCGTCAGTCTGCAAT
جهت انجام PCR،DNA  استخراج‌شده از نمونه‌های مایع منی به همراه پرایمر‌های مربوطه در واکنشPCR وارد شدند (جدول شماره 2). در مرحله بعد از برنامه PCR شامل: دناتوراسیون اولیه 95 درجه سانتیگراد به مدت 5 دقیقه با یک تکرار و دناتوراسیون در 95 درجه سانتیگراد به مدت 25 ثانیه، اتصال پرایمرها در 54 درجه سانتیگراد به مدت 40 ثانیه، تکثیردر 72 درجه سانتیگراد به مدت 1 دقیقه با 37 بار تکرار و تکثیر نهایی در 72 درجه سانتیگراد به مدت 5 دقیقه با یک تکرار انجام گرفت. در نهایت، جهت بررسی نتیجه PCR، ازروش الکتروفورز در ژل آگارز 5/1% استفاده گردید.
 
جدول شماره2: مواد واکنش PCR
Negative control Sample Material
21.5µl 21.5µl Buffer PCR
1µl 1µl Forward primer
1µl 1µl primer Reverse
0 15ng DNA
1µl 0 H2O
0.25µl 0.25µl Taq DNA Polymerase 5Unit/µl))
 
در این تحقیق، از DNA سویه استاندارد مایکوپلاسما هومینیس ATCC 23114)) تهیه‌شده از مؤسسه تحقیقات واکسن و سرم‌سازی رازی، به‌عنوان کنترل مثبت استفاده شد. داده‌ها با استفاده از نرم‌افزارSPSS  نسخه 22، آزمون‌ تی‌تست وابسته و مستقل تحلیل شدند. سطح معنی‌داری، 05/0p< در نظر گرفته شد.
 
یافته‌ها
نتایج ردیابی و شناسایی مایکوپلاسما هومینیس در نمونه‌های منی مردان نابارور نشان داد از 187 نمونه مایع منی، 71 نمونه (38%) به مایکوپلاسما هومینیس آلوده‌اند که در واکنش PCR، باندی در محدوده 334 جفت باز ایجاد کرده بودند (شکل). 116 نمونه (62%) نیز فاقدآلودگی با مایکوپلاسما هومینیس بودند.

 
 
 
 
 
 
 
 
 
شکل: نتایج الکتروفورزمحصول PCR.
ستون 1،6 مارکر bp)100)، ستون 2 سویه استاندارد مایکوپلاسما هومینیس ATCC 23114))؛ ستون 3، 4 نمونه آلوده با مایکوپلاسما هومینیس؛ ستون 5 کنترل منفی.
 
میانگین حجم مایع منی در مردان آلوده با مایکوپلاسما هومینیس، 6/1±5/3، تعداد اسپرم ml/(106 )6/45±7/79 و میزان درصد تحرک 6/19±2/50 بود.
میانگین حجم مایع منی در مردان فاقد آلودگی با مایکوپلاسما هومینیس، 6/1±9/3، تعداد اسپرم /ml(106 ) 9/49±5/67 و میزان درصد تحرک 4/22±8/44 برآورد شد.
براساس نتایج کلاس a،b و c در مردان آلوده با مایکوپلاسما هومینیس، میانگین حرکت اسپرم‌ها در کلاس a، 8/1±7/5؛ میانگین حرکت اسپرم‌ها در کلاس b، 9/11±4/24 و میانگین حرکت اسپرم‌ها در کلاس c، 4/8±30 بود. بین آلودگی باکتریایی و اختلاف میانگین مشاهده‌شده در حرکت کلاسc، رابطه معنی‌داری وجود داشت (008/0=p). در مردان فاقدآلودگی با مایکوپلاسما هومینیس، میانگین حرکت اسپرم‌ها در کلاس a، 9/5±5/8؛ میانگین حرکت اسپرم‌ها در کلاس b، 6/12±2/25 و میانگین حرکت اسپرم‌ها در کلاس c ،7/10±1/26 برآورد شد. فقط درکلاس c این دو گروه با هم اختلاف معنی‌داری داشتند (007/0=p).
میانگین pH در مردان آلوده با مایکوپلاسما هومینیس، 06/0±7/7 و در مردان فاقد آلودگی با مایکوپلاسما هومینیس، 05/0±7/7 بود.
بررسی شکل اسپرم‌ها نشان داد در مردان آلوده با مایکوپلاسما هومینیس، به‌طورمیانگین درصد شکل طبیعی، 6/3±1/4 و شکل غیرطبیعی 6/11±7/94 بوده است. در مردان فاقد آلودگی با مایکوپلاسما هومینیس، به‌طور میانگین درصد شکل طبیعی، 3/4±2/4 و شکل غیرطبیعی، 7/9±8/94 به دست آمد.
 
بحث
عفونت مجرای ادراری - تناسلی مردان، یکی از مهم‌ترین عوامل ناباروری در مردان است، به‌طوری‌که 35-8% موارد ناباروری مردان در سراسر جهان ناشی از این نوع عفونت‌ها می‌باشد. مایکو‌پلاسماها همراه با کلامیدیا به‌عنوان مهم‌ترین عوامل بیماریزای فرصت‌طلب در دستگاه تناسلی شناخته شده‌اند که از راه تماس جنسی منتقل و باعث ایجاد بیماری در دستگاه تناسلی می‌شوند (13). مایکوپلاسما هومینیس در عفونت‌های باکتریایی مهبل و  لوله‌های تخم‌بر، عفونت زخم سزارین، پیلونفریت، همچنین اورتریت نقش دارد (7)، که در صورت عدم درمان، به ناباروری و نازایی منتهی می‌‌شود (14،15).
در مطالعات مختلف گزارش شده است برای شناسایی مایکوپلاسماهای تناسلی، روش PCR در مقایسه با روش کشت، روش تشخیصی کارآمدتری است؛ زیرا مایکوپلاسماها به دلیل فقدان دیواره سلولی در برابر شرایط محیطی (pH، خشکی، دما) بسیار حساس هستند. همچنین مایکوپلاسما‌ها سخت رشد بوده و نیازمند محیط‌های کشت اختصاصی با مکمل‌های غذایی می‌باشند؛ بنابراین ممکن است در مراحل نمونه‌برداری، انتقال به آزمایشگاه و کشت دادن، باکتری‌ها از دست رفته و نتیجه کشت منفی کاذب ایجاد کنند. از طرف دیگر، کشت مایکوپلاسما هومینیس در شرایط مطلوب به 5-2 روز زمان نیاز دارد، در‌حالی‌که با روش PCR می‌توان در چند ساعت با حساسیت بالا، چندین نمونه را مورد بررسی قرار داد و نتایج را منعکس کرد که به دلایل فوق در تحقیق حاضر، از روش PCR برای شناسایی این باکتری استفاده گردید (16).
در مطالعه‌ای‌ توسط Gadoura و همکاران درکشور تونس در بررسی آلودگی مایکوپلاسما هومینیس در مایع منی مردان نابارور با روش PCR، میزان شیوع مایکوپلاسما هومینیس، 8/10% گزارش شد (17). از آنجایی‌که در تحقیق حاضر میزان شیوع مایکوپلاسما هومینیس، 38% بود؛ لذا مقایسه نتایج با مطالعات فوق نشان داد میزان آلودگی در شهر قم بالاتر از کشور تونس بوده است. گلشنی و همکاران نیز در تهران در بررسی آلودگی مایکوپلاسما هومینیس در نمونه‌های مایع منی مردان نابارور با روش PCR، میزان آلودگی را 11% گزارش کردند (8) که در مقایسه با تحقیق حاضر، پایین‌تر بود. در تحقیق دیگری توسط نیاکان و همکاران در تهران (سال 1386) بر روی نمونه‌های مایع منی 40 مرد نابارور، فراوانی مایکوپلاسما هومینیس، 5/17% اعلام شد، اما این یافته به‌علت محدود‌بودن تعداد افراد مورد بررسی، نمی‌تواند آمار صحیحی از شیوع این ارگانیسم را دربرداشته باشد (18).
احمدی و همکاران در تهران با بررسی آلودگی مایکوپلاسما هومینیس در نمونه‌های مایع منی مردان نابارور با استفاده از روش PCR، میزان آلودگی مایکوپلاسما هومینیس را 5/15% گزارش کردند (2). از آن‌جایی‌که در تحقیق حاضر، میزان شیوع مایکوپلاسما هومینیس، 38% بود؛ بنابراین، مقایسه این یافته با نتایج مطالعات فوق نشان داد میزان آلودگی در شهر قم بالاتر از تهران می‌باشد.
در مطالعه دیگری که توسط جمالی‌زاده و همکاران در سیرجان انجام گرفت، در بررسی آلودگی مایکوپلاسما هومینیس با روش PCR، میزان آلودگی مایکوپلاسما هومینیس، 5/37% اعلام شد (19). که این یافته با نتیجه تحقیق حاضر همخوانی داشت. از طرف دیگر، با مقایسه نتایج محققان در سال‌های مختلف می‌توان به این نکته اشاره کرد که آلودگی با مایکوپلاسما هومینیس در افراد نابارور در سال‌های اخیر به‌طور قابل‌توجهی افزایش یافته است. همچنین تأکید می‌گردد کلونیزه شدن مایکوپلاسما هومینیس در دستگاه ادراری - تناسلی و آلودگی با آن، ارتباط معنی‌داری با عواملی نظیر شرایط اجتماعی - اقتصادی پایین، فقر، عفونت‌های باکتریایی دیگر و تفاوت در توزیع جغرافیایی جمعیت‌ها دارد (20).
در مورد تأثیر مایکوپلاسماهای تناسلی بر شاخص‌های اسپرم و نقش آن‌ها در ایجاد تغییرات آندرولوژی مایع منی و ایجاد ناباروری در مردان، دیدگاه‌های متفاوت و بعضاً متناقضی وجود دارد (21،22)؛ به عنوان مثال، برخی گزارش‌ها حاکی از آن است که حضور مایکوپلاسماها در مایع منی، می‌تواند سبب ایجاد تأثیرات منفی بر حجم، pH، تحرک، شکل، تعداد و قابلیت حیاتی اسپرم‌ها شود (23). در‌حالی‌که برخی از محققان هیچ‌گونه ارتباطی را بین حضور این باکتری‌ها در مایع منی و ایجاد تغییرات در شاخص‌های اسپرم نیافته‌اند (2). به هر حال مطالعات آزمایشگاهی نشان می‌دهد گرما‌گذاری اسپرم‌ها با مایکوپلاسماها می‌تواند باعث آسیب رساندن به فیزیولوژی اسپرم‌ها، به‌خصوص سبب تأثیرات منفی بر روی قدرت تحرک، شکل و قابلیت حیاتی آن‌ها گردد (2). براساس یک مطالعه، گرما‌گذاری همزمان مایکوپلاسما هومینیس و اسپرم‌ها به مدت یک‌شبانه‌روز از نظر آماری، اثر واضحی روی حرکت، شکل و قدرت باروری آنها دارد (4،23). در مطالعه احمدی و همکاران در تهران نشان داده شد بین آلودگی مایکوپلاسما هومینیس در مایع منی، شاخص‌های pH و قدرت تحرک اسپرم، ارتباط معنی‌داری وجود دارد (2). در تحقیق حاضر با توجه به نتایج آنالیز آماری مشخص گردید بین آلودگی باکتریایی و اختلاف میانگین در کلاس c (حرکت درجا)، رابطه معنی‌داری وجود دارد.
 
نتیجه‌گیری
با توجه به یافته‌های این تحقیق، درصد نسبتاً بالایی از مردان نابارور در شهر قم به این باکتری آلوده‌اند که درصورت عدم تشخیص و درمان می‌تواند باعث عفونت دستگاه تناسلی ادراری و ناباروری گردد. لذا درمان آنتی‌بیوتیک و تست‌های میکروبی برای مردان نابارور، ضروری به‌نظر می‌رسد.
 
تشکر و قدرانی
بدین‌ وسیله از کارکنان مرکز درمان فوق‌تخصصی ناباروری جهاد دانشگاهی قم، به‌ویژه جناب آقای مهندس کلهر، مؤسسه تحقیقات واکسن و سرم‌سازی رازی که ما را در انجام این پژوهش یاری رساندند، تشکر و قدرانی می‌نماییم.
 
References:
 
  1. Kilic D, Basar M, Kaygusuz S, Yilmaz E, Basar H, Batislam E. Prevalence and treatment of Chlamydia trachomatis, Ureaplasma urealyticum and Mycoplasma hominis in patients with non-gonococcal uretritis. Jpn J Infect Dis 2004;57(1):17-20. PubMed
 
  1. Ahmadi MH, Amirmozafari N, Sedighi-Gilani MA, Kazemi B, Masjedian-Jazi F. Comparison of culture with PCR for detection of Mycoplasma hominis and Ureaplasma urealyticum in semen samples of infertile men referring to the Royan Institute in 2009. Razi J Med Sci 2010;17(76):15-29. [Full Text in Persian] Link
 
  1. Andrade-Rocha FT. Ureaplasma urealyticum and Mycoplasma hominis in men attending for routine semen analysis, prevalence and incidence by age and clinical settings, influence on sperm characteristics, relationship with the leukocyte count and clinical value. Urol Int 2003;71(4):377-81. PubMed
 
  1. Fanaei H, Mardaneh J, Khayat S. An overview of the role of bacterial infection in male infertility Zahedan University of Medical Sciences, Iran. J Fasa Univ Med Sci 2012;2(4):227-34. [Full Text in Persian] Link
 
  1. Yoshida T, Maeda S, Deguchi T, Miyazawa T, Ishiko H. Rapid detection of Mycoplasma enitalium, by PCR-microtiter plate hybridization assay. J Clin Microbiol 2003;41(5):1850-55. PubMed
 
  1. Soffer Y, Ron-El R, Golan A, Herman A, Caspi E, Samra Z. Male genital mycoplasmas and Chlamydia trachomatis culture: its relationship with accessory gland function, sperm quality, and autoimmunity. Fertil Steril 1990;53(2):331-6. PubMed
 
  1. Vosoughi S, gaergaha B, Karimi nek A, Mirshekari T. Mycoplasma infections in human role in infertility review. New Cell Mol Biol Biotechnol 2012;2(8):9-20. [Full Text in Persian] Link
 
  1. Golshani M, Eslami G, Mohhammadzadeh Ghobadloo Sh, Fallah F, Goudarzi H, et al. Detection of Chlamydia trachomatis, Mycoplasma hominis and Ureaplasma urealyticum by Multiplex PCR in semen sample of infertile men. Iran J Publ Health 2007;36(2):50-57. Link
 
  1. Trevor C. WHO laboratory manual for the examination and processing of human semen. 5th ed. 2010. Geneva: WHO; 2010. Link
 
  1. Bacerat Z, Jorsaraei SGh. Study improve human sperm parameters after preparation method Swim up. J Obstetrics Gynecol Infertil Univer Med Scien babol Iran 2008;11(4):1-7. [Full Text in Persian]
 
  1. Anvar Z, Namavar-Jahromi B, Ebrahimi S, Gharesi-Fard B. Genomic DNA extraction from sperm. J Adv Med Sci Appl Technol 2015;1(1):120-21. Link
 
  1. Blanchard A, Yanez A, Dybvig K, Watson HL, Griffiths G, Cassell GH. Evaluation of interspecies genetic variation within the16S rRNA gene of Mycoplasma hominis and detection by polymerase chain reaction. J Clin Microbiol 1993;31(5):1358-61. PubMed
 
  1. Stellrecht KA, Woron AM, Mishrik NG, Venezia RA. Comparison of multiplex PCR assay with culture for detection of genital mycoplasmas. J Clin Microbiol 2004;42(4):1528-33. PubMed
 
14. Vosoughi S, Benevolent B, Mirshekari TR, Karimi Nick A, Hmydavy Pour S, Moghadam N.    
Molecular detection of Mycoplasma hominis from genital secretions of infertile men referred to the Kerman infertility center. J Microbial World 2013;14(1):14-22. [Full Text in Persian] Link
 
  1. Wang Y, Liang CL, Wu JQ, Xu C, Qin SX, Gao ES. Do Ureaplasma urealyticum infections in the genital tract affect semen quality? Asian J Androl 2006;8(5):562-68. PubMed
 
  1. Luki N, Lebe PM, Boucher M, Doray B, Turgeon J, Brousseau R. Comparison of PCR assay with culture for detection of genital mycoplasmas in perinatal infections. Eur J Clin Microbiol Infect Dis 1998;17(4):255-63. PubMed
 
  1. Gadoura R, Kchaou W, Ammar-keskes L, Chacroun N, Sellemi A, Znazen A, et al. Assessment of Chlamydia trachomatis, Ureaplasma urealyticum, Ureaplasma parvum, Mycoplasma hominis and Mycoplasma genitalium in semen and first void urine specimens of asymptomatic male partners of infertile couples. J Androl 2008;29(2):198-206. PubMed
 
  1. Niakan M, Forootan SK, Fallah N, Shafiei M, SedighiMA, Nejad Moghaddam MR, et al. Detection the frequencyof M. Hominis in infertile men with control group. Scien-Res Shahed Univer 2005;56(12):65-72. [Full Text in Persian]
 
  1. Jamalizadeh S, Mohseni N, Kheirkhah B, Farsinejad A, Habibzadeh V. Isolation and molecular identification of Mycoplasma hominis in infertile female and male reproductive system. NephroUrol Mon 2014;6(6):1-6. PubMed
 
  1. Clegg A, Passey M, Yoannes M, Michael A. High rates of genital Mycoplasma infection in the Highlands of Papua New Guinea determined both by culture and by a commercial detection Kit. J Clin Microbiol 1997;35(1):197-200. PubMed
 
  1. Potts JM, Sharma R, Pasqualotto F, Nelson D, Hall G, Agarwal A. Association of Ureaplasma urealyticum with abnormal reactive oxygen species levels and absence of leukocytospermia. J Urol 2000;163(6):1775-8. PubMed
 
  1. Sanocka-Maciejewska D, Ciupinska M, Kurpisz M. Bacterial infection and semen quality. J Reprod Immunol 2005;67(1-2):51-56. PubMed
 
23. Rose BI, Scott B. Sperm motility, morphology, hyperactivation and ionophore- induced acrosome reactions after overnight incubation with Mycoplasma. Fertil Steril 1994;61(2):341-46. PubMed
 
 
نوع مطالعه: مقاله پژوهشي | موضوع مقاله: میکروب شناسی
دریافت: 1396/1/27 | پذیرش: 1396/4/25 | انتشار: 1397/3/25

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

ارسال پیام به نویسنده مسئول


بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.

کلیه حقوق این وب سایت متعلق به مجله دانشگاه علوم پزشکی قم می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق
© 2024 CC BY-NC 4.0 | Qom University of Medical Sciences Journal

Designed & Developed by : Yektaweb