دوره 12، شماره 4 - ( تیر 1397 )                   جلد 12 شماره 4 صفحات 22-16 | برگشت به فهرست نسخه ها


XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Alamshah N, Sari S, Mirfakhrae R. Association of miR-146a rs2910164 Variant with Multiple Sclerosis Disease in Hamadan Province (Iran). Qom Univ Med Sci J 2018; 12 (4) :16-22
URL: http://journal.muq.ac.ir/article-1-1654-fa.html
عالمشاه نوین، ساری سویار، میرفخرایی رضا. ارتباط واریانت miR-146a rs2910164با بیماری مالتیپل‌اسکلروزیس، در استان همدان. مجله دانشگاه علوم پزشکی قم. 1397; 12 (4) :16-22

URL: http://journal.muq.ac.ir/article-1-1654-fa.html


1- گروه علوم سلولی مولکولی، دانشکده علوم و فناوری‌های نوین، واحد علوم دارویی، دانشگاه آزاد اسلامی، تهران، ایران.
2- ۱گروه علوم سلولی مولکولی، دانشکده علوم و فناوری‌های نوین، واحد علوم دارویی، دانشگاه آزاد اسلامی، تهران، ایران.
3- گروه ژنتیک پزشکی، دانشگاه علوم پزشکی شهید بهشتی، تهران، ایران.
متن کامل [PDF 388 kb]   (983 دریافت)     |   چکیده (HTML)  (4915 مشاهده)
متن کامل:   (990 مشاهده)
مقدمه
مالتیپل‌اسکلروزیس (MS)، یک بیماری خودایمنی با التهاب مزمن غلاف میلین در سیستم عصبی مرکزی است که مجموعه‌ای از فاکتورهای ژنتیکی و محیطی در ایجاد آن نقش دارند (4-1). طبق بررسی‌های صورت‌گرفته، بیماری MS در مناطق اروپای شمالی، آمریکا و شرق میانی نسبت به کشورهای دیگر شیوع بیشتری دارد (9-5). در دهه اخیر به‌طور نگران‌کننده‌ای، شیوع این بیماری در ایران رو به افزایش بوده و طبق گزارش‌ها میزان آن در زنان نسبت به مردان بیشتر بوده است (14-10). با توجه به اهمیت این بیماری و پژوهش‌های متعددی که بر روی پلی‌مورفیسم ژن‌های دخیل در ارتباط با این بیماری انجام شده، تاکنون مطالعات اندکی بر روی واریانت‌های miRNA‌ها و ارتباط آن‌ها با بیماری MS صورت گرفته است (15،16). miRNA‌ها گروه کوچکی از RNA‌های غیر‌کد‌کننده و تک‌رشته‌ای هستند که طول آن‌ها بین 24-18 نوکلئوتید می‌باشد و در تنظیم بیان ژن در سطح پس از رونویسی نقش مهمی ایفا می‌کنند، همچنین آن‌ها با تجزیه و یا جلوگیری از ترجمه mRNA هدف، در جلوگیری از ایجاد بیماری‌ها نقش دارند (19-17). میکرو‌RNA‌ها معمولاً به کمک RNA پلیمراز II رونویسی‌شده و mRNA اولیه را به‌وجود می‌آورند و سپس از طریق پروتئین exportin5 از هسته به ماتریکس سیتوزولی منتقل و با شکسته‌شدن به‌وسیله آندوریبونوکلئاز Dicer به miR بالغ دو رشته‌ای تبدیل و از طریق اتصال به ناحیه 3'UTR در mRNA هدف باعث عدم ترجمه آن می‌شوند و به این ترتیب از ایجاد بیماری جلوگیری می‌کنند. با توجه به اهمیت و نرخ شیوع بیماری و ارتباط آن‌ها با پلی‌مورفیسم میکرو‌RNA‌ها، بررسی واریانت‌های میکرو‌RNA‌ها در کشور ضروری به‌نظر می‌رسد، به‌طوری‌که miRNA‌ها نقش مهمی در ایجاد بیماری‌ها و انواع سرطان‌ها دارند؛ به‌عنوان مثال Li و همکاران (سال ۲۰۱۴)، ارتباط پلی‌مورفیسم -146a miRNA با بیماری چینی مبتلا به MS را بررسی کردند (20). Ridolfi و همکاران (سال ۲۰۱۳) نیز ارتباط چندشکلی میکروRNA 23a و بیماری MS را با استفاده از Real time PCR در جمعیت ایتالیا (شامل ۳۹۹ بیمار و ۴۲۰ فرد به‌عنوان گروه کنترل) نشان دادند (21). miR-146a، یکی از miRNA‌های است که نقش آن در تنظیمات پاسخ‌های ایمنی و التهابات به‌خوبی شناخته شده، همچنین در بیماری‌های مختلفی مانند روماتوئید آرتریت، لوپوس و مالتیپل‌اسکلروزیس، مکان آن روی کروموزوم 5 با موقعیت 5q34 گزارش شده است.
با توجه به اینکه پلی‌مورفیسم miRNA‌ها و نقش آن‌ها در بسیاری از بیماری‌ها و بیماری MS اثبات شده است، و نظر به اهمیت آن‌ها در درمان بیماری‌ها، بررسی نقش پلی‌مورفیسم miRNA‌ها در بیماران ایرانی ضروری است؛ بنابراین در این مطالعه به بررسی نقش پلی‌مورفیسم miR-146a rs2910164 در ایجاد بیماری MS در بیماران استان همدان پرداخته شد.
 
روش بررسی
در این مطالعه مورد شاهدی، 150 بیمار مبتلا به مالتیپل‌اسکلروزیس و 150 فرد سالم به‌عنوان گروه کنترل انتخاب شدند.
نمونه‌گیری خون از 150 فرد مبتلا به بیماری مالتیپل‌اسکلروزیس (MS)، مراجعه‌کننده به مرکز MS همدان و بیمارستان فرشچیان به عمل آمد. نمونه‌ها براساس امکانات و دسترسی محدود به آن‌ها، و حجم نمونه برمبنای مفهوم واژه پلی‌مورفیسم (به‌معنی وجود حداقل دو آلل شایع یا تعداد بیشتر در جمعیت با فراوانی بیش از ۱%) تعیین شدند. 63% نمونه‌ها زن و مابقی مرد بودند و میانگین افراد شرکت‌کننده 61 سال بود. همه بیماران در فاز RR-MS Relapsing-Remitting Multiple Sclerosis)( به سر می‌بردند (این فاز حالتی از بیماری است که عود مجدد حملات بیماری را در برمی‌گیرد)(جدول شماره 1)
جدول شماره 1: مشخصات ویژگی‌های بالینی افراد مورد مطالعه
افراد سالم افراد بیمار شاخص
59-20 69-17 سن (سال)
 
58% 63% زن جنسیت
42% 37% مرد
 
 
 
 
 
 
 
ابتدا 4 میلی‌لیتراز خون محیطی افراد در لوله‌های حاوی EDTA ریخته شد. DNA با روش نمک اشباع (Salting out)، استخراج و تا زمان بررسی در دمای ۲۰- درجه سانتیگراد نگهداری شد.
در این مطالعه، جهت بررسی چندشکلی miR146a > (rs 2910164) و طراحی پرایمر‌های مورد نیاز، با مراجعه به بانک اطلاعاتی dpSNP موجود در پایگاه اینترنتی http://www.ncbi.nlm.nih.gov/SNP و به کمک نرم‌افزار Primer1، یک جفت پرایمر بیرونی (Outer) و یک جفت پرایمر درونی (Inner) طراحی گردید، همچنین این پرایمر‌ها توسط سرویس بلاست موجود در سایت NCBI برای یافتن نواحی دارای همولوژی در ژنوم انسان و جهت ساخت به شرکت تکاپو زیست سفارش داده شدند. توالی پرایمرها در جدول شماره 2 نشان داده شده است.
طول محصولات PCR در افراد دارای ژنوتیپ CC، 240 و 355 جفت باز، در افراد با ژنوتیپ GG، 170 و 355 جفت باز و در افراد هتروزیگوت CG، 170 و 355 و 240 جفت باز می‌باشد.
واکنش PCR در حجم ۲۵ میکرولیتر حاوی ۲ میکرولیتر DNA ژنومی، ۱۰ میکرولیتر (Amplicon Denmark)Master mix PCR X۲، تهیه‌شده از شرکت ویراژن، ۱ میکرولیتر از پرایمرهای داخلی، 5/0 میکرولیتر از پرایمرهای خارجی صورت گرفت. تکثیر در ۳۲ سیکل، تحت دمای ۹۴ درجه سانتیگراد به‌مدت ۵ دقیقه، ۹۴ درجه سانتیگراد به مدت ۱ دقیقه، دمای اتصال پرایمرها 7/61 درجه سانتیگراد به مدت ۱ دقیقه، دمای ۷۲ درجه سانتیگراد ۴۵ ثانیه و دمای طویل‌سازی ۷۲ درجه سانتیگراد با زمان ۵ دقیقه انجام شد، سپس محصولات PCR روی ژل آگارز ۲% (حاوی 7/0 میکرولیتر رنگ Redsafe) و در کنار Ladder 50bp(SMO Bio Taiwan) بارگذاری شدند و باندها با استفاده از دستگاه ترانس ایلومیناتور مورد بررسی قرار گرفتند. در ادامه، تعدادی از نمونه‌ها جهت مشخص شدن ژنوتیپ، تعیین توالی شدند.
 
 
 
 
جدول شماره 2: توالی پرایمرهای مورد استفاده جهت بررسی چندشکلی mir 146a و پرایمرهای داخلی
پرایمر فوروارد خارجی
5΄TACTCCAGATGTTTATAACTCATGAGTGCC..3΄
توالی
پرایمر ریورس خارجی
5΄ATATATTCAGAGCCTGAGACTCTGCCTT3΄
توالی
پرایمر فوروارد داخلی
5΄TATAGGTTGTGTCAGTGTCAGACGTG.3΄
توالی
پرایمر ریورس داخلی
5΄ATTATACTCTGCCTTCTGTCTCCAGTCT.3΄
توالی
 
از آزمون مربع‌کای و نرم‌افزارآنلاین SNPStats (http://bioinfo.iconcologia.net/SNPstats جهت تعیین وجود تعادل یا عدم آن با قانون تعال هاردی - واینبرگ در دو گروه مورد مطالعه، همچنین وجود ارتباط بین پلی‌مورفیسم مورد بررسی و وقوع بیماری MS استفاده شد.
 
یافته‌ها
در این تحقیق، وجود ارتباط میان واریانت miR146a rs 2910164 با بروز بیماری MS در 150 بیمار مورد بررسی قرار گرفت. در هیچ‌کدام از حالت‌های غالب و مغلوب، ارتباط معنی‌داری بین ژنوتیپ‌های دو گروه بیمار و کنترل مشاهده نشد (جدول شماره 3).
 
جدول شماره 3: فراوانی اللی و ژنوتیپی در جمعیت مورد مطالعه
 
SNP.146 allele frequencies
Stat=Co Stat=Ca All subjects
Allele Count Proportion Count Proportion Count
C 446 74/0 218 73/0 228
G 154 26/0 82 27/0 72
SNP.146 association with response Stat (n=300 crude analysis(
p OR (95% CI) Stat=Co Stat=Ca Genotype Model
37/0 1 86 (3/57%) 75 (50%) C/C Codominant
  72/0 (15/1-45/0) 56 (3/37%) 68 (3/45%) C/G
  00/1 (88/2-35/0) 8 (3/5%) 7 (7/4%) G/G
2/0 1 86 (3/57%) 75 (50%) C/C Dominant
  74/0 (17/1-47/0) 64 (7/42%) 75 (50%) C/G-G/G
79/0 1 142 (7/94%) 143 (3/95%) C/C-C/G Recessive
  15/1 (26/3-41/0) 8 (3/5%) 7 (7/4%) G/G
16/0 1 94 (7/62%) 82 (7/54%) C/C-G/G Overdominant
72/0 (14/1-45/0) 56 (3/37%) 68 (3/45%) C/G
 
بحث
بررسی miRNA‌ها و شناسایی عملکردشان در بسیاری از بیماری‌ها شامل: انواع مختلف سرطان، عفونت، حتی بیماری‌های خود‌ایمنی مانند MS مورد توجه قرار گرفته است. نقش تنظیمی آنها نه تنها به مشخص‌تر شدن عملکرد بسیاری از ژن‌ها کمک می‌کند؛ بلکه می‌تواند در تشخیص و درمان بیماری نیز به‌عنوان یک بیومارکر کاربرد داشته باشد. تاکنون چندین مطالعه با هدف تعیین بیان miRNA‌ها در بیماران مبتلا به MS با تکنیک‌هایی مانند Taq Man-RT PCR و ریز‌آرایه (Micro array) انجام شده که نتایج این مطالعات، نشان‌دهنده تفاوت در الگوی بیانی افراد بیمار در مقایسه با افراد سالم مانند کاهش بیان miR-17 و miR-20 و بالعکس افزایش بیان miR-145 در بیماران MS در مقایسه با گروه کنترل بوده است (19). Li و همکاران (سال ۲۰۱۴) در مطالعه خود با بررسی ارتباط پلی‌مورفیسم miR-146a G>C rs2910144 با بیماری MS در ۳۸۱ زن بیمار چینی و ۳۷۸ فرد سالم، افزایش ژنوتیپ GC و CC را در زنان بیمار چینی در مقایسه با زنان سالم نشان دادند  (20). Ridolfi و همکاران (سال ۲۰۱۳) نیز با بررسی ارتباط چندشکلی میکرو RNA 23a و بیماری MS با استفاده از Real time PCR در جمعیت ایتالیا (شامل ۳۹۹ بیمار و ۴۲۰ فرد به‌عنوان گروه کنترل)، نشان دادند بیان miR-23a در سرم بیماران MS نسبت به نمونه کنترل دچار تنظیم کاهشی بوده است، همچنین افزایش مهمی در آلل C پلی‌مورفیسم miR-23a C>T(rs 3745453) در مقایسه با افراد کنترل گزارش کردند (21). در مطالعه حاضر مشخص گردید miR-146a rs2910164 با بروز بیماری MS در جمعیت ایرانی ارتباطی ندارد، درحالی‌که پلی‌مورفیسم miR-146a rs2910164 در جمعیت چین با بروز بیماری MS ارتباط معنی‌داری نشان داد. اختلاف در یافته‌های تحقیقات مشابه با مطالعه حاضر، می‌تواند به‌علت قومیت مورد بررسی باشد؛ زیرا در مطالعات دیگر قومیت از عوامل اصلی تعیین‌کننده وجود یا عدم همراهی و تعداد نمونه مورد بررسی عامل دیگری است که می‌تواند توجیه‌کننده تفاوت بین این مطالعات باشد. در نتیجه، افزایش تعداد نمونه‌ها و یا بررسی همراهی در سایر قومیت‌های ایرانی می‌تواند نتایج متفاوتی را در پی داشته باشد. بنابراین، توصیه می‌شود این مطالعه در حجم بزرگتر و در اقوام مختلف ایرانی تکرار شود.
 
نتیجه‌گیری
با توجه به نتایج مطالعه حاضر می‌توان بیان کرد پلی‌مورفیسم rs2910164، در ژن miR146a، ارتباط معنی‌داری با بیماری MS در جمعیت مورد بررسی
ندارد.
 
تشکر و قدردانی
این تحقیق حاصل نتایج بخشی از پایان‌نامه کارشناسی ارشد است. بدین‌وسیله از همکاری ارزشمند ریاست محترم آزمایشگاه ژنتیک پزشکی نیکا تهران، جناب آقای دکتر حبیب نصیری و نیز تمامی افراد شرکت‌کننده در طرح تحقیقاتی پایان‌نامه تشکر و قدردانی می‌گردد.

 
 References:
  1. Ambros V. The functions of animal microRNAs. Nature 2004;431(7006):350-5. PubMed
  2. Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, et al. Identification of hundreds of conserved and nonconserved human microRNAs. Nat Genet 2005;37(7):766-70. PubMed
  3. Clemente D, Ortega MC, Arenzana FJ, de Castro F. FGF-2 and Anosmin-1 are selectively expressed in different types of multiple sclerosis lesions. J Neurosci 2011;31(42):14899-909. PubMed
  4. Coolen M, Bally-Cuif L. MicroRNAs in brain development and physiology. Curr Opin Neurobiol 2009;19(5):461-70. PubMed
  5. Croce CM. Causes and consequences of microRNA dysregulation in cancer. Nat Rev Genet 2009;10(10):704-14. PubMed
  6. Dai R, Ahmed SA. MicroRNA, a new paradigm for understanding  immunoregulation, inflammation, and autoimmune diseases. Transl Res 2011;157(4):163-79. PubMed
  7. Deng JH, Deng P, Lin SL, Ying SY. Gene silencing in vitro and in vivo using intronic microRNAs. Methods Mol Biol 2006;342:295-312. PubMed
  8. Doerksen SE, Motl RW, McAuley E. En-vironmental correlates of physical activity in multiple sclerosis: a cross-sectional study. Int J Behav Nutr Phys Act 2007;4:49. PubMed
  9. Etemadifar M, Sajjadi S, Nasr Z, Firoozeei TS, Abtahi SH, Akbari M, et al. Epidemiology of multiple sclerosis in Iran. Eur Neurol 2013;70(5-6):356-63. PubMed
  10. Goodin DS. Magnetic resonance imaging as a surrogate outcome measure of disability in multiple sclerosis: have we been overly harsh in our assessment Ann Neurol 2006;59(4):597-605. PubMed
  11. Guerau-de-Arellano M, Alder H, Ozer HG, Lovett-Racke A, Racke MK. et al. miRNA profiling for biomarker discovery in multiple sclerosis: From microarray to deep sequencing. J Neuroimmunol 2012;248(1-2):32-9. PubMed
  12. Gregory RI, Chendrimada TP, Shiekhattar R. MicroRNA biogenesis: Isolation and characterization of the microprocessor complex. Methods Mol Biol 2006;342:33-47. PubMed
  13. Hauser SL, Oksenberg JR. The neurobiology of multiple sclerosis: genes, inflammation, and neurodegeneration. Neuron 2006;52(1):61-76. PubMed
  14. He X, Yu Y, Awatramani R, Lu QR. Unwrapping myelination by microRNAs. Neuroscientist 2012;18(1):45-55. PubMed
  15. Hedrich CM, Tsokos GC. Epigenetic mechanisms in systemic lupus erythematosus and other autoimmune diseases. Trends Mol Med 2011;17(12):714-24. PubMed
  16. Jazdzewski K, Murray EL, Franssila K, Jarzab B, schoenberg DR, de la Chapelle A, et al: Common SNP in pre-miR-146a decreases mature mir expression and predisposes to papillary thyroid carcinoma. Proc Natl Acad Sci USA 2008;105(20):7269-74. PubMed
  17. Junker A, Krumbholz M, Eisele S, Mohan H, Augstein, F, Bittner R, et al. MicroRNA profiling of multiple sclerosis lesions identifies modulators of the regulatory protein CD47. Brain 2009;132(Pt 12):3342-52. PubMed
  18. Koch-Henriksen N, Sorensen PS. Why does the north–south gradient of incidence of multiple sclerosis seem to have disappeared on the Northern hemisphere J Neurol Sci 2011;311(1-2):58-63. PubMed
  19. Kurtzke JF. A reassessment of the distri-bution of multiple sclerosis. Acta Neurol Scand 1975;51(2):137-57. PubMed
  20. Li Y, Du C, Wang W, MA G, Cui L, Zhou H, et al. Genetic association of MiR-146a with Multiple Sclerosis Susceptibility in the Chinese Population. Cell Physiol Biochem 2015;35(1):281-91. PubMed
  21.  Ridolfi E, Fenoglio C, Cantoni C, Calvi A, De Rize M, Pietroboni A, et al. Expression and genetic analysis of MicRNAs involved in multiple sclerosis. Int J Mol Sci 2013;14(3):4375-84. PubMed
 
 
 
 
نوع مطالعه: مقاله پژوهشي | موضوع مقاله: سلولی و مولکولی
دریافت: 1396/3/4 | پذیرش: 1396/5/7 | انتشار: 1397/3/25

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.

کلیه حقوق این وب سایت متعلق به مجله دانشگاه علوم پزشکی قم می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق
© 2024 CC BY-NC 4.0 | Qom University of Medical Sciences Journal

Designed & Developed by : Yektaweb