دوره 12، شماره 4 - ( تیر 1397 )                   جلد 12 شماره 4 صفحات 9-1 | برگشت به فهرست نسخه ها


XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

GHiyasi S, Ameri Z, Hassanshahi G, Mirzaee R, Ehsan M, Pouryazdanpanah N, et al . The Effect of Telomerase Inhibition on the Expression of Inflammatory Cytokines Affecting the Pathogenesis of Multiple Myeloma Cell Line U266. Qom Univ Med Sci J 2018; 12 (4) :1-9
URL: http://journal.muq.ac.ir/article-1-1659-fa.html
غیاثی سعیده، عامری زهرا، حسن شاهی غلامحسین، میرزایی روح الله، احسان محسن، پوریزدان پناه نوشین، و همکاران.. تأثیر مهارکننده تلومراز بر روی بیان سایتوکاین‌های التهابی مؤثر در پاتوژنز میلوم‌مولتیپل، در رده سلولی میلومی U266. مجله دانشگاه علوم پزشکی قم. 1397; 12 (4) :1-9

URL: http://journal.muq.ac.ir/article-1-1659-fa.html


1- 1گروه هماتولوژی، دانشکده پیراپزشکی، دانشگاه علوم پزشکی کرمان، کرمان، ایران.
2- مرکز تحقیقات سلولی و مولکولی، دانشکده پزشکی، دانشگاه علوم پزشکی رفسنجان، رفسنجان، ایران
3- گروه هماتولوژی، دانشکده پیراپزشکی، دانشگاه علوم پزشکی کرمان، کرمان، ایران.
4- روه هماتولوژی، دانشکده پزشکی، دانشگاه تربیت مدرس، تهران، ایران.
5- گروه هماتولوژی، دانشکده پیراپزشکی، دانشگاه علوم پزشکی کرمان، کرمان، ایران. ، ahmad.fatemi2@gmail.com
متن کامل [PDF 888 kb]   (1156 دریافت)     |   چکیده (HTML)  (5121 مشاهده)
متن کامل:   (1603 مشاهده)
مقدمه
مالتیپل‌میلوما (Multiple Myeloma, MM)، دومین بدخیمی هماتولوژیک است که 15-10% بیماری‌های خونی را شامل می‌شود. در حالت نرمال، پلاسماسل آخرین سلول رده لنفوسیت B بوده که در تولید آنتی‌بادی نقش دارد، اما تکثیر خارج از کنترل آن‌ها در بیماری مالتیپل‌میلوما منجر به دردهای استخوانی، عفونت، کم‌خونی، شکستگی‌های استخوانی، همچنین افزایش سطح کلسیم خون می‌گردد. متوسط بقا در این بیماری قبل از شروع شیمی‌درمانی، حدود 7 ماه است. یکی ازعلل اصلی بدخیم شدن سلول‌ها، اختلال در مسیر سیگنال‌دهی NF-κB است (1). فاکتور رونویسی NF-κB نقش مهمی در بقا و تکثیر انواع مختلف تومورهای لنفوسیت B، به‌ویژه MM دارد. اینترلوکین - 6 (IL-6)، فاکتور رشد اصلی پلاسماسل‌های بدخیم بوده که باعث بقای سلول‌های توموری و مقاومت به آپوپتوز این سلول‌ها در MM می‌شود. این سایتوکاین با دیگر فاکتورهای دخیل در پاتوژنز MM مانند ژن‌های سرکوب‌کننده تومور و انکوژن‌ها برهمکنش دارد. همچنین در پروموتور ژن اینترلوکین - 6، ناحیه‌ای برای اتصال فاکتور رونویسی NF-κB مشاهده می‌شود (2). از طرفی،  NF-κB منجر به تولید انواع مختلفی از میانجی‌های التهابی، ازجمله TNFα می‌گردد (3). فاکتور نکروزدهنده تومور (TNFα)، سایتوکاینی التهابی است که در بسیاری از فعالیت‌های سلولی نظیر تکثیر، آپوپتوز و پیام‌های بقا نقش دارد (4)، و این پیام، بقا را از طریق فعالیت NF-κB میانجی‌گری می‌کند (5). تحقیقات نشان داده‌اندTNFα  با فعال‌کردن مسیر NF-κB در سلول‌های میلومی باعث افزایش تکثیر سلولی می‌شود. همچنین افزایش سطح TNFα در بیماران مبتلا به MM با شدت بیماری مرتبط است (6). از سویی،TNFα  منجر به فعال شدنNF-κB  و افزایش 5 برابری اینترلوکین - 6 می‌گردد (7).
تلومراز، عامل دیگر دخیل در مسیرهای پیام‌رسانی سلولی (آنزیمی با دو زیرواحد کاتالیتیک TERT و دو زیرواحد ریبونوکلئوتیدی TERC) باعث افزایش طول تلومر در انتهای کروموزم‌ها می‌شود (8). تلومراز آنزیمی است که در 90-80% سرطان‌ها بیان می‌شود؛ درصورتی‌که در حالت طبیعی صرفاً سلول‌های بنیادی و جنسی دارای تلومراز فعال هستند. سلول‌های توموری با فعالیت تلومرازی بالا، ویژگی‌هایی چون افزایش تکثیر، مقاومت به درمان، تهاجم و کاهش آپوپتوز را نشان می‌دهند. اما اخیراً مطالعات، پرده از نقش‌های غیرتلومریک تلومراز برداشته‌اند. فعال‌شدن تلومراز و NF-κB، نقشی اساسی در بسیاری ازسرطان‌ها دارند. بیان نابجای تلومراز منجر به افزایش سطح بیان NF-κB و ژن‌های هدف آن می‌گردد (9). مطالعات نشان داده است تنظیم بیان ژن به‌واسطه تلومراز برای اینترلوکین - 6 و TNFα اختصاصی است. بنابراین، به‌نظر می‌رسد مهار همزمان تلومراز و NF-κB، استراتژی درمانی خوبی در بدخیمی‌ها باشد. از آنجا‌که درمان‌های رایج کنونی برای این بیماری دارای عوارض جانبی متعدد بوده و باوجود این داروها، MM همچنان به‌عنوان بدخیمی غیرقابل‌درمان محسوب می‌شود، لذا نیاز به شناخت داروهای جدیدتر احساس می‌‌گردد. در این میان، روش‌های مختلفی تاکنون جهت مهار عوامل متعدد دخیل در سیگنالینگ سلولی، ازجمله مهار فعالیت تلومرازی مطرح است (9). از آنجایی‌که داروهای با منشأ شیمیایی دارای سازگاری کمتری با بدن انسان نسبت به داروهای با منشأ گیاهی هستند؛ بنابراین داروهای گیاهی امروزه جهت تحقیقات در زمینه شیمی‌درمانی بیشتر مورد توجه‌اند (10). نتایج مطالعات پیشین حاکی از اثرات ضدسرطانی ترکیبات کاتچین می‌باشد. این تحقیقات نشان داده‌اند اپی‌گالو کاتچین گالات (EGCG)، کاتچین اصلی چای سبز، به‌طور قوی و مستقیم باعث مهار تلومراز می‌‌شود. دارویMST-312  (مشتقی از اپی‌گالو کاتچین) در مهار تلومراز مؤثرتر از ترکیب اصلی، یعنی اپی‌گالو کاتچین عمل می‌کند. این ترکیبات، امید را برای درمان سرطان در میان دانشمندان زنده کرده‌اند (11). همچنین به‌طور شگفت‌انگیز، این دارو بر روی سلول‌های نرمال خونی (سلول‌های تک‌هسته‌ای خون) هیچ‌گونه اثر سویی ندارد (1). این تحقیق با هدف بررسی اثر مهارکننده تلومراز بر روی بیان سایتوکاین‌های التهابی مؤثر در پاتوژنز میلوم مولتیپل در رده سلولی میلومی U266انجام گرفت.
 
روش بررسی
در این مطالعه تجربی، رده سلولی U266 (مربوط به بیماری مالتیپل‌میلوما) از مرکز ذخایر ژنتیک ایران تهیه و سلول‌های U266 در محیط کشت
 RPMI 1640 غنی‌شده با سرم جنین گاوی)%(FBS 10، پنی‌سیلین (110 یونیت بر‌میلی‌لیتر) استرپتومایسین (100 میکروگرم بر‌میلی‌لیتر)، در انکوباتور کشت سلول با دمای 37 درجه سانتیگراد، هوای حاوی 5% دی‌اکسید کربن و رطوبت 95% کشت داده شدند. محلول ذخیره MST-312 (Sigma-Aldrich, USA) با حل‌کردن آن در DMSO تهیه و غلظت‌های مناسب محلول کار از محلول ذخیره با استفاده از محیط کشت ساخته شدند. تأثیر MST-312 روی مرگ سلول‌های میلومی با استفاده از آنالیز آپوپتوز بررسی گردید. به‌طور خلاصه، سلول‌های U266 در پلیت کشت سلول 12 خانه با تراکم 105×2 سلول در هر خانه کشت داده شدند و با غلظت‌های مورد نظر (2، 4 و 8 میکرومولار) MST-312 به مدت 48 ساعت انکوبه شدند. نمونه سلولی که مورد تیمار با MST-312 قرار نگرفت (غلظت صفر)، به‌عنوان کنترل منفی در نظر گرفته شد. بعد از اتمام انکوباسیون، سلول‌ها دو مرتبه با PBS شسته و با استفاده از کیت آنکسین V شناسایی‌کننده آپوپتوز (BD Biosciences, USA)، رنگ شدند. پس از خالی‌کردن PBS رویی، به هر پک سلولی، 100 میکرولیتر بایندینگ بافر (1X)، 5 میکرولیتر آنکسین PE-V و 5 میکرولیتر محلول رنگ 7AAD اضافه شد. پس از یک ورتکس ملایم، نمونه‌ها به مدت 15 دقیقه در تاریکی انکوبه شدند. پس از اتمام انکوباسیون، 400 میکرولیتر بایندینگ بافر (1X) به سوسپانسیون سلولی اضافه و با دستگاه فلوسایتومتر Becton Dickinson FACS آنالیز گردید. درصد سلول‌های آپوپتوزی با استفاده از نرم‌افزار Cell Ques تعیین شدند. هر آزمایش 3 مرتبه تکرار شد. سلول‌هایی که آنکسین V مثبت و 7AAD منفی بودند در فاز اولیه، آپوپتوز در نظر گرفته شدند و سلول‌هایی که هم آنکسین V و هم 7AAD مثبت داشتند در مراحل انتهایی، آپوپتوز تلقی شدند. بعد از انجام روش فلوسایتومتری، سلول‌های میلومی (U266) برای 48 ساعت با داروی MST-312 (2 میکرومولار) تیمار شده و RNA این سلول‌ها با استفاده از محلول TriPure (Roche) با توجه به دستور کارخانه استخراج گردید. واکنش رونویسی معکوس (RT) با استفاده از کیت سنتز DNA مکمل {(RevertAid First Strand complementary DNA (cDNA) Synthesis kit from Fermentas)} از فرمنتاز تهیه شد. 20 میکرولیتر در هر واکنش حاوی 9 میکرولیتر آب تهی از نوکلئاز، 1 میکرولیتر پرایمر رندوم هگزامر، 4 میکرولیتر 5× Reaction Buffer، 2 میکرولیتر مخلوط
 dNTP (10mM)، 1 میکرولیتر RiboLock RNase Inhibitor (20U/μl)  و 1 میکرولیتر ترانسکریپتاز معکوس
(200U/μl) RevertAid M-MuLV به‌عنوان مسترمیکس و 2 میکرولیتر از RNA توتال (1 میکروگرم در هر واکنش) به مسترمیکس اولیه اضافه شد. برای سنتز cDNA هر واکنش 20 میکرولیتری با برنامه دمایی زیر در دستگاه ترموسایکلر قرار گرفت:
 5 دقیقه در 25 درجه سانتیگراد انکوبه شد و در پی آن 60 دقیقه در دمای 42 درجه سانتیگراد قرار گرفت. واکنش با حرارت دادن آن در 70 درجه سانتیگراد برای 5 دقیقه خاتمه یافت.
واکنش Real-time PCR با استفاده از 5/7 میکرولیتر مسترمیکس گرین 2  (Ampliqon)، 5/1 میکرولیتر از cDNA ساخته‌شده، 1 میکرولیتر از هرکدام از پرایمر‌های Forward و Reverse (10pmol)، 4 میکرولیتر آب با حجم نهایی 15 میکرولیتر انجام شد. چرخه‌های دمایی شامل: مرحله فعال‌سازی اولیه با دمای 95 درجه سانتیگراد به مدت 15 دقیقه و در ادامه با 40 سیکل دمایی که هر چرخه دارای مرحله دناتوراسیون با دمای 95 درجه سانتیگراد به مدت 15 ثانیه و یک مرحله ادغامی اتصال پرایمر و مرحله طویل‌سازی (annealing/ elongation) در دمای 60 درجه سانتیگراد به مدت 60 ثانیه بود. واکنش در دستگاه ABI Biosystem انجام شد. برای تأیید اختصاصی‌بودن محصولات تولید‌شده، آنالیز منحنی ذوب صورت گرفت. از ژن GAPDH به‌عنوان ژن Housekeeping  جهت نرمالیزه‌کردن نتایج بیان ژن‌ها استفاده شد. بیان نسبی ژن‌های هدف با استفاده از روش مقایسه‌ای∆∆CT طبق فرمول 2∆∆CT محاسبه گردید و بیان هر ژن سه بار تکرار شد. ∆∆CT با فرمول زیر محاسبه گردید:
∆∆CT = (CTtreated – CTcontrol) targeted gene – (CTtreated – CTcontrol) GAPDH
 CT (Threshold Cycle): تلاقی بین منحنی تکثیر و خط آستانه؛
Treated: گروه تیمارشده با دارو؛
 Control: گروه تیمارنشده با دارو.
جدول شماره 1: توالی پرایمرهای Reverse و Forward ژن‌ها
Gene Forward Reverse
GAPDH 5′- GAAGGTGAAGGTCGGAGTC -3′ 5′- GAAGATGGTGATGGGATTTC -3′
TNFα 5′- GCTGCACTTTGGAGTGATCGG -3′ 5′- TGGGCTACAGGCTTGTCACT -3′
IL-6 5′- AGCCAGAGCTGTGCAGATGA -3′ 5′- CTGCAGCCACTGGTTCTGTG -3′
hTERT 5′- ATGCGACAGTTCGTGGCTCA -3′ 5′- ATCCCCTGGCACTGGACGTA -3′
 
 
 
 
 
 
 
 
داده‌ها با استفاده از نرم‌افزار SPSS و آزمون Two-tailed Student’s t test تجزیه و تحلیل شدند.
 
یافته‌ها
القای آپوپتوز سلول‌های میلومیU266  به‌وسیله داروی MST-312 صورت گرفت. به‌منظور تعیین تأثیر MST-312 روی آپوپتوز سلولی، سلول‌های میلومی به‌وسیله کیت PE آنکسین-V شناسایی‌کننده آپوپتوز آنالیز شدند.
سلول‌های Annexin منفی/ 7-AAD منفی به‌عنوان سلول‌های زنده در نظر گرفته شدند. سلول‌های Annexin مثبت/ 7-AAD منفی در مرحله اولیه آپوپتوز قرار داشتند. سلول‌های Annexin مثبت/ 7-AAD مثبت در مراحل انتهایی آپوپتوز بوده و سلول‌های Annexin منفی/ 7-AAD مثبت نکروتیک تلقی شدند. انکوباسیون کوتاه‌مدت سلول‌های میلومی با MST-312 به‌طور مشخص، سلول‌های آنکسین-V مثبت/ 7AAD منفی و آنکسین-V مثبت/ 7AAD مثبت را افزایش داد که نشان‌دهنده تأثیر آپوپتوتیک MST-312 روی سلول‌های میلومی بود. همچنین تأثیر آپوپتوزی وابسته به دوز بوده و تقریباً 30% افزایش آپوپتوز در سلول‌های U266 بعد از مواجهه کوتاه‌مدت (48 ساعت) با غلظت 2 میکرومولار MST-312 دیده شد. این غلظت 2 میکرومولار که با آپوپتوز قابل‌توجهی همراه است، به‌عنوان غلظت مورد استفاده در بررسی بیان ژن انتخاب گردید (شکل شماره 1).

شکل شماره 1: تأثیر MST-312 روی آپوپتوز سلول‌های U266.
سلول‌های U266 با غلظت‌های مختلف MST-312 به مدت 48 ساعت تیمار شدند،سپس اتصال این سلول‌ها به آنکسین-V /7AAD مورد بررسی قرار گرفت. یک آزمایش از سه مرتبه تکرار نشان داده شده است.(01/0** p<001/0 *p<05/0p<).
 
کاهش بیان سایتوکاین‌های التهابی IL-6 و TNFα  به‌وسیله داروی  MST-312صورت گرفت. ژن‌های IL-6 و TNFα دو ژن مهم در تکثیر، بقا و پاتوژنز مالتیپل‌میلوما بودند. در سلول‌های میلومی تیمار‌شده با غلظت 2 میکرومولار در کوتاه‌مدت (48 ساعت)، بیان ژن IL-6 و TNFα کاهش یافت. همچنین بیان ژن TERT نیز در مقایسه با کنترل کاهش، حاکی از کاهش فعالیت تلومرازی بود (نمودار شماره 1).
 
 
 
شکل و نمودار شماره 1: تأثیر MST-312 روی آپوپتوز سلول‌های U266.  سلول‌های U266 با غلظت‌های مختلف MST-312 به مدت 48 ساعت تیمار شدند، سپس اتصال این سلول‌ها به آنکسین-V /7AAD مورد بررسی قرار گرفت. یک آزمایش از سه مرتبه تکرار نشان داده شده است.
(01/0** p<001/0 *p<05/0p<).
 
داروی مهارکننده تلومراز MST-312، بیان ژن‌های التهابی IL-6، TNF-α و ژن hTERT را کاهش دادند. پس از تیمار سلول‌های U266 با داروی MST-312 (دوز 2 میکرومولار در بازه زمانی 48 ساعت) نیز RNA استخراج و cDNA سنتز شد.
نتایج Sybr-green real-time PCR با استفاده از پرایمرهای اختصاصی نشان داده شده است (نمودار شماره 2).
 

نمودار شماره 2: تأثیر MST-312 روی بیان ژن‌های التهابی IL-6، TNF-α و ژن hTERT در سلول‌های U266.
پس از تیمار سلول‌های U266 با داروی MST-312 (دوز 2 میکرومولار در بازه زمانی 48 ساعت) RNA استخراج و cDNA سنتز شد. نتایجybr-green real-time PCR با استفاده از پرایمرهای اختصاصی نشان داده شده است. همه مقادیر به‌وسیله بیان ژن GAPDH نرمالیزه شدند. نتایج به‌صورت سه بار تکرار (n= 3) و همه مقادیر به‌‌صورت میانگین±انحراف معیار (Mean±S.D) ارائه شده‌اند. (*p<0.05، **p<0.01، در مقایسه با سلول‌های تیمارنشده با MST-312).
همه مقادیر به‌وسیله بیان ژن GAPDH نرمالیزه شدند. نتایج به‌صورت سه بار تکرار (n= 3) و همه مقادیر به‌‌صورت میانگین±انحراف معیار (Mean±S.D) ارائه شدند (*p<0.05، **p<0.01، در مقایسه با سلول‌های تیمارنشده با MST-312).
 
بحث
درمان هدفمند (Targeted Therapy) در سرطان به‌ معنی درمان با عوامل و موادی است که از طریق مداخله با مولکول‌ها و مسیرهای پیام‌رسانی خاص، مانع رشد و گسترش سرطان می‌شوند. توسعه درمان هدفمند، نیازمند شناخت دقیق اهداف دارویی و مولکول‌های درگیر در پروسه سرطان‌زایی است و در این میان، هدف قرار دادن آن دسته از مولکول‌ها حایز اهمیت و تأثیر بیشتری است که نقش‌های کلیدی را در تومورزایی ایفا می‌کنند (12) مالتیپل‌میلوما نیز مانند سایر سرطان‌ها به‌دلیل درگیری مولکول‌های خاص تومورزا، کاندید درمان هدفمند و توسعه درمانی در این زمینه است. امروزه، با شناخت مسیرهای پیام‌رسانی در مالتیپل‌میلوما و علم به مولکول‌های کلیدی دخیل در پاتوژنز این بیماری، پیشرفت‌هایی حاصل شده است، اما همچنان این بیماری یک بیماری غیرقابل درمان محسوب شده و لذا نیاز به یافتن راهکارهای جدید درمانی ضروری به‌نظر می‌رسد (13). همچنین با توجه به نقش بالای فعالیت  تلومراز و ارتباط ذکرشده آن با فاکتور رونویسی NF-κB در مالتیپل‌میلوما به‌عنوان یکی از اصلی‌ترین و کلیدی‌ترین مولکول‌های دخیل در بیماریزایی این بدخیمی، دانشمندان راهکارهای مختلفی جهت مهار تلومراز ارائه و آزمایش کرده‌اند؛ چراکه مهار NF-κB ممکن است به سلول‌های نرمال نیز آسیب برساند، اما تلومراز جزء سلول‌های جنسی و بنیادی بوده و فعالیت چندانی در سلول‌های سوماتیک ندارد. لذا هدف قرار‌دادن آن کمترین آسیب را در برخواهد داشت (14). در تحقیقات پیشین، ترکیبات مختلفی به‌عنوان مهارکننده تلومراز معرفی شدند (15). در این میان، اپی‌گالو کاتچین گالات (EGCG) که کاتچین اصلی چای سبز است، به‌صورت مؤثری تلومراز را مهار می‌کند. مشتقات مختلفی از این ماده )شامل:MST- 312 ، MST-295 وMST-199 ) در دسترس است که در این بین، MST-312 به‌طور مؤثرتری تلومراز را مهار می‌کند (16). مطالعات قبلی در تومورهای مغزی نشان داده‌اند بسته به زمان مواجهه با دارو، MST-312 دارای دو اثر متفاوت است: اثر حاد کوتاه‌مدت که در پی مواجهه کوتاه‌مدت (72ساعت) با MST-312 رخ می‌دهد و منجر به آسیب DNA، توقف چرخه سلولی در G2/M و افزایش مرگ سلولی می‌شود (17). این اثر مستقل از کوتاه‌شدن تلومر بوده و به‌وسیله جدا‌کردن کمپلکس تلومراز از DNA تلومر، سپس شناسایی تلومر به‌عنوان شکست DNA دو رشته‌ای توسط مسیر ATM وساطت می‌گردد و تیمار طولانی‌مدت (بیش از یک‌ماه و نیم) که منجر به کوتاه‌شدن قابل‌توجه طول تلومر می‌شود (18). MST-312 مانند سایر مهارکننده‌های تلومرازی درصورت تیمار کوتاه‌مدت دارای اثرات حادی بوده که مستقل از کوتاه‌شدن طول تلومری است. این اثر حاکی از نقش‌های غیرکانونی تلومراز یا به‌عبارتی مستقل ازکاهش طول تلومر است. همچنان‌که مطالعات اخیر نیز به این نقش‌ها اشاره کرده‌اند، ازجمله این فعالیت‌ها می‌توان تنظیم سیکل سلولی، بیان ژن و تنظیم مسیر سیگنالینگ NF-κB توسط تلومراز را نام برد (19،20). در همین راستا، با توجه به اینکه ژن‌های هدف فاکتور رونویسی NF-κB، من‌جمله IL-6 و TNF-α نقش مهمی در رشد و بقای سلول‌های میلومی دارند؛ در مطالعه حاضر برای اولین بار اثر این دارو روی رده سلولی میلومی U266 بررسی گردید.
در این مطالعه با توجه به نتیجه تحقیقات فاطمی و همکاران مبنی بر اثرات داروی MST-312 بر روی تلومراز و اثرات ثانویه آن مانند مهار فاکتور رونویسی NF-κB و قطع ارتباط ذکرشده این دو (1)، رده سلولی U266 به‌عنوان یک رده با توان تولید اتوکراین IL-6، با داروی ضدتلومرازی MST-312 در غلظت 2 میکرومولار و زمان 48 ساعت (کوتاه‌مدت )تیمار شد و مشخص گردید این دارو مانع فعالیت‌های تکثیرزایی و بقای سلول‌های میلومی یا به‌عبارتی، کاهش تولیدIL-6  و TNFα به‌عنوان کلیدی‌ترین عوامل در بیماریزایی مالتیپل‌میلوما می‌شود. جالب توجه است نتایج مطالعات قبلی نشان داده‌اند داروی MST-312 هیچ تأثیری بر روی سلول‌های طبیعی منونوکلئار خون محیطی (PBMC) ندارد (1). این موضوع بیان می‌کند که MST-312 تأثیر مهاری انتخابی بر روی رشد سلول‌های میلومی داشته و می‌تواند به‌عنوان کاندیدی جهت درمان مالتیپل‌میلوما پیشنهاد گردد.
 
نتیجه‌گیری
در این مطالعه اثر کاهش سایتوکاین‌های التهابی دخیل در پاتوژنز مالتیپل‌میلوما بر روی رده‌های سلولی U266 نشان داده شد با توجه به نتایج، MST-312 را می‌توان به‌عنوان ماده‌ای با اثر مهاری در برابر سلول‌های مالتیپل‌میلوما در نظر گرفت. تحقیقات گسترده‌تر جهت شناخت مکانیسم‌های اثر این دارو نیاز است.
 
تشکر و قدردانی
بدین وسیله نویسندگان این مقاله از معاونت درمان و آزمایشگاه پیوند اعضای دانشگاه علوم پزشکی کرمان جهت حمایت‌های علمی و کارمندان مرکز که در اجرای این طرح همکاری کردند، تشکر و قدردانی می‌نمایند.
کد ارکید:
 Orcid Code: Zahra Ameri=0000-0002-4478-2142
Orcid Code: Saeede Ghiyasi=0000-0002-3243-6285
Orcid Code: Shima Kazemzadeh=0000-0002-2197-3827
Orcid Code: Noushin Pouryazdanpanah=0000-0002-9777-500X
Orcid Code: Gholamhossein Hassanshahiraviz=0000-0002-4829-1586
Orcid Code: Mohsen Ehsan=0000-0001-8195-4487
Orcid Code: Rouhollah Mirzaei=0000-0002-8626-4853
Orcid Code: Ahmad Fatemi=0000-0002-9869-0147
 
References:
 
  1. Fatemi A, Safa M, Kazemi A. MST-312 induces G2/M cell cycle arrest and apoptosis in APL cells through inhibition of telomerase activity and suppression of NF-κB pathway. Tumour Biol 2015;36(11):8425-37. PubMed
 
  1. Gadó K, Domján G, Hegyesi H, Falus A. Role of interleukin6 in the pathogenesis of multiple myeloma. Cell Biol Int 2000;24(4):195-209. PubMed
 
  1. Treon SP, Anderson KC. Anderson, Interleukin-6 in multiple myeloma and related plasma cell dyscrasias. Curr Opin Hematol 1998;5(1):42-8. PubMed
 
  1. Mauro C, Zazzeroni F, Papa S, Bubici C, Franzoso G. The NF-κB transcription factor pathway as a therapeutic target in cancer: Methods for detection of NF-κB activity. Methods Mol Biol. 2009;512:169-20. PubMed
 
  1. Zhou A, Scoggin S, Gaynor RB, Williams NS. Identification of NF-kappaB-regulated genes induced by TNFalpha utilizing expression profiling and RNA interference. Oncogene 2003;22(13):2054-64. PubMed
 
  1. Gupta S, Bi R, Kim C, Chiplunkar S, Yel L, Gollapudi S. Role of NF-kappa B signaling pathway in increased tumor necrosis factor-alpha-induced apoptosis of lymphocytes in aged humans. Cell Death Differ 2005;12(2):177-83. PubMed
 
  1. Hideshima T, Chauhan D, Schlossman R, Richardson P, Anderson KC. The role of tumor necrosis factor alpha in the pathophysiology of human multiple myeloma: therapeutic applications. Oncogene 2001;20(33):4519-27. PubMed
 
  1. Jöhrer K, Janke K, Krugmann J, Fiegl M, Greil R. Transendothelial migration of myeloma cells is increased by tumor necrosis factor (TNF)-α via TNF receptor 2 and autocrine up-regulation of MCP-1. Clin Cancer Res 2004;10(6):1901-10. PubMed
 
  1. Chang JT, Chen YL, Yang HT, Chen CY, Cheng AJ. Differential regulation of telomerase activity by six telomerase subunits. Eur J Biochem 2002;269(14):3442-50. PubMed
 
  1. Ghosh A, Saginc G, Leow SC, Khattar E, Shin EM, Yan TD, et al, Telomerase directly regulates NF-κB-dependent transcription. Nat Cell Biol 2012;14(12):1270-81. PubMed
 
  1. Dorman HJ, Deans SG. Antimicrobial agents from plants: antibacterial activity of plant volatile oils. J Appl Microbiol 2000;88(2):308-16. PubMed
 
  1. Cunningham AP, Love WK, Zhang RW, Andrews LG, Tollefsbol TO. Telomerase inhibition in cancer therapeutics: molecular-based approaches. Curr Med Chem 2006;13(24):2875-88. PubMed
 
  1. Gerber DE. Targeted therapies: A new generation of cancer treatments Am Fam Physician 2008;77(3):311-9. PubMed
 
  1. Dolloff NG, Talamo G. Targeted therapy in multiple myeloma. Adv Exp Med Biol 2013;779:197-221. PubMed
 
  1. Kim NW, Piatyszek MA, Prowse KR, Harley CB, West MD, Ho P, et al. Specific association of human telomerase activity with immortal cells and cancer. Science 1994;266(5193):2011-5. PubMed
 
  1. Olaussen KA, Dubrana K, Domont J, Spano JP, Sabatier L, Soria JC. Telomeres and telomerase as targets for anticancer drug development. Crit Rev Oncol Hematol 2006;57(3):191-214. PubMed
 
  1. Shay JW, Wright WE. Telomerase: A target for cancer therapeutics, in Gene-Based Therapies. Cancer Cell 2010;2(4):257-65. Link
 
  1. Serrano D, Bleau AM, Fernandez-Garcia I, Fernandez-Marcelo T, Iniesta P, Ortiz-de-Solorzano C, et al. Inhibition of telomerase activity preferentially targets aldehyde dehydrogenase-positive cancer stem-like cells in lung cancer. Mol Cancer 2011;10:96. PubMed
 
  1. Gellert GC, Dikmen ZG, Wright WE, Gryaznov S, Shay JW. Effects of a novel telomerase inhibitor, GRN163L, in human breast cancer. Breast Cancer Res Treat 2006;96(1):73-81. PubMed
 
 
  1. Kraemer K, Fuessel S, Schmidt U, Kotzsch M, Schwenzer B, Wirth MP, et al. Antisense-mediated hTERT inhibition specifically reduces the growth of human bladder cancer cells. Clin Cancer Res 2003;9(10 Pt 1):3794-800. PubMed
 
 
 
نوع مطالعه: مقاله پژوهشي | موضوع مقاله: علوم آزمایشگاهی
دریافت: 1396/3/7 | پذیرش: 1396/4/25 | انتشار: 1397/3/25

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

ارسال پیام به نویسنده مسئول


بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.

کلیه حقوق این وب سایت متعلق به مجله دانشگاه علوم پزشکی قم می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق
© 2024 CC BY-NC 4.0 | Qom University of Medical Sciences Journal

Designed & Developed by : Yektaweb