دوره 14، شماره 5 - ( مرداد 1399 )                   جلد 14 شماره 5 صفحات 29-22 | برگشت به فهرست نسخه ها


XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Shabani M, Mohammad Ganji S, Salahshourifar I. Investigation of Long Non-coding RNA HOX A11-AS Expression in Iranian Patients with Glioblastoma: A Quantitative Study. Qom Univ Med Sci J 2020; 14 (5) :22-29
URL: http://journal.muq.ac.ir/article-1-2816-fa.html
شعبانی منصوره، محمد گنجی شهلا، سلحشوری فر ایمان. مطالعه کمّی میزان بیان lncRNA HOX A11As در بیماران ایرانی مبتلابه گلیوبلاستوما. مجله دانشگاه علوم پزشکی قم. 1399; 14 (5) :22-29

URL: http://journal.muq.ac.ir/article-1-2816-fa.html


1- گروه ژنتیک، دانشکده علوم پایه، واحد علوم و تحقیقات، دانشگاه آزاد اسلامی، تهران، ایران.
2- گروه پزشکی مولکولی، پژوهشکده بیوتکنولوژی پزشکی، پژوهشگاه ملی مهندسی ژنتیک و زیست‌فناوری، تهران، ایران. ، shahlamg@yahoo.com
متن کامل [PDF 725 kb]   (767 دریافت)     |   چکیده (HTML)  (2580 مشاهده)
متن کامل:   (1468 مشاهده)
مقدمه
گلیوبلاستوما مولتی‌فرم (GBM: Glioblastoma Multiforme) شایع‌ترین و مهاجم‌ترین نوع گلیوماست که معمولاً در مخ ایجاد می‌شود که این ناحیه کنترل‌کننده فرایندهایی مثل تکلم و احساسات است. این تومور با تراکم سلولی بالا، آناپلازی واضح سلولی همراه با نکروز و تکثیر عروق یا تکثیر اندوتلیوم رگ‌ها مشخص می‌شود (1). درحالی‌که گلیوبلاستوما مولتی‌فرم تهاجم زیادی به سلول‌های اطراف تومور در مغز دارد، به‌ندرت در ارگان‌های دیگر پخش می‌شود. گلیوبلاستوما مولتی‌فرم سرطانی تهاجم بالا و رشد سریعی دارد و معالجه به مکان تومور و توانایی بیمار به تحمل جراحی بستگی دارد؛ بنابراین، این سرطان به‌سختی درمان می‌شود (2). گلیوما 29 تا 35 درصد از تومورهای سیستم عصبی مرکزی را در نوجوانان تشکیل می‌دهد. از این مقدار دوسوم گلیومای درجه پایین (I و II) و بقیه گلیومای درجه بالاتر (III و IV) هستند (3). آمار اخیر اداره ثبت تومور مغزی ایالات‌متحده آمریکا (CBTRUS: Central Brain Tumor Registry of the United States) از کل تومورهای مغز و سیستم عصبی مرکزی بیان می‌کند که 1/15 درصد از تومورهای مغزی، گلیوبلاستوما هستند که دومین گروه بزرگ بعد از مننژیوم خوش‌خیم (9/35 درصد) هستند (4). استفاده از بیومارکرها به‌عنوان هدف جدیدی برای درمان بسیار اهمیت دارد (5). امروزه RNAهای بلند غیرکدکننده (lncRNA: Long non-coding RNA) به‌عنوان نشانگر بالقوه‌ای برای تشخیص انواع مختلف سرطان استفاده می‌شوند. بسیاری از مطالعات آشکار کرده‌اند که این RNA‌های بلند غیرکدکننده به‌عنوان عصر جدیدی، در تشخیص و مدیریت سرطان نقش دارند. اخیراً RNAهای بلند غیرکدکننده به‌عنوان بیومارکر فعال شناسایی و معرفی می‌شوند و در تشخیص و پیش‌آگاهی سرطان‌های مختلف مسیر‌های انکوژنیک و ساپرسیو مهمی هستند (6). از میان RNAهای بلند غیرکدکننده، می‌توان به Homebox A11 Antisense RNA (HOXA11-AS) اشاره کرد. RNAهای بلند غیرکدکننده محافظت‌شده در خوشه ژن HOXA در کروموزوم 7، 2/15p قرار دارد که شامل ژن‌های کدکننده و غیرکدکننده پروتئین هستند. AS در ابتدا در کتابخانه cDNA جنینی موش با استفاده از پروب از توالی cDNA HOXA11 Sense کشف شده است. HOXA11-ASدر چند سرطان به‌عنوان بیومارکر برای تشخیص زودهنگام عمل می‌کند؛ مانند سرطان‌های تخمدان، اپی‌تلیال، دهانه رحم و گلیوبلاستوما (7).
در این مطالعه بیان HOXA11-AS در بافت گلیوما و سطوح تنظیمی در بافت تومور در مقایسه با بافت طبیعی مجاور بررسی شد. آزمایش‌های اعتبارسنجی تأییدشده مطالعه حاضر نقش HOXA11-ASرا بر گلیوما نشان می‌دهد (8). HOXA11-AS‏‏ یک RNA غیرکدکننده با توالی بلند است که با مراحل چرخه سلولی در ارتباط می‌باشد و اگر از آن رونویسی شود، دارای عملکرد انکوژنیک خواهد داشت و به‌عنوان بیومارکری در مراحل پیشرفته گلیوما معرفی می‌شود. HOXA11-AS‏ ‏از طریق تنظیم روند پیشرفت چرخه سلول، باعث ارتقای گلیوماژنز می‌شود (8).
هدف از این پژوهش، سنجش بیان lncRNA HOXA11-AS در مبتلایان به گلیوما و بررسی نقش بیان RNAهای بلند غیرکدکننده HOX11-AS در تشخیص و افتراق درجات مختلف گلیوما است.
 
روش بررسی
پس از گرفتن رضایت‌نامه کتبی از بیماران (موجود در پرونده پزشکی بیمارستان امام حسین)، نمونه‌های مغز (شامل بیوپسی بافت توموری) را که پزشک متخصص جراح مغز و اعصاب در سال‌های 94 تا 96 برداشته و جمع‌آوری کرده بود، متخصص پاتولوژیست تأیید و تعیین درجه کرد. برای انجام این پروژه 50 نمونه بافت توموری گلیوما از نوع درجه 2 و1 و 50 نمونه بافت توموری از نوع درجه 4 و3، مورد نیاز بود. تمام بیماران اهداکننده فرم رضایت‌نامه را برای استفاده از نمونه‌های بافتی آن‌ها در پروژه تحقیقاتی امضا کرده بودند. همچنین بانک ملزم به رعایت اصول اخلاقی مربوطه در زمینه جمع‌آوری و استفاده از نمونه‌ها بود. جراحان در اتاق عمل نمونه را تهیه کردند و پس از تأیید پاتولوژی در این بانک زیستی ذخیره شدند. بافت‌های استفاده‌شده در این پژوهش شامل این دو گروه بودند: 1. بافت توموری متعلق به بیماران مبتلابه تومور مغزی گلیوما از نوع درجه 1 و 2؛ 2. بافت توموری متعلق به بیماران مبتلابه تومور مغزی گلیوما از نوع درجه 3 و4. این نمونه‌های بافتی به‌صورت پارافینه نگهداری می‌شدند. برای برش‌زدن میزان لازم از بافت‌های مذکور به‌منظور استخراج RNA، هر یک از بافت‌ها درون یک پلیت خاص روی یخ خشک برش زده و سپس توزین شدند. میزان لازم برای استخراج RNA 8 تا 10 میلی‌گرم منظور شد. سپس بافت مذکور به میکروتیوب‌های 5/1 استریل عاری از DNAse/RNAse منتقل، پارافینه و نگهداری شدند. استخراج RNA از نمونه بافت‌های جمع‌آوری‌شده با به‌کارگیری کیت استخراج miRNA شرکت MN آلمان به شماره کاتالوگ 740304 انجام شد. سپس برای سنجش کمیت RNA استخراج‌شده رقت 50/1 از RNA تهیه و با دستگاه اسپکتروفوتومتر غلظت و نسبت 280/260 اندازه‌گیری شد. RNA استخراج‌شده در آب فوق‌العاده خالصRNase-free در دمای 70- درجه سانتی‌گراد نگهداری شد.
به‌منظور کنترل کیفیت RNA‌های به‌دست‌آمده، 3 میکرولیتر از آن روی ژل 8/0 درصد آگارز روان شد و کیفیت RNA استخراج‌شده ازنظر وجود و کیفیت باندهای RNA ریبوزومی 18s و 28s کنترل شد. وجود این باند‌ها و نیز دو برابر بودن شدت باند rRNA 28S نسبت به rRNA 18S نشانگر سالم‌بودن RNA است. درصورتی‌که RNA به‌طور نسبی خرد و قطعه‌قطعه شده باشد، ظاهر لکه‌ای دارد و فاقد باندهای واضح rRNA یا نسبت 2:1 است. RNA کاملاً مضمحل‌شده به‌صورت لکه‌ای با وزن مولکولی بسیار کم دیده می‌شود.
به‌منظور سنتز cDNA از RNA استخراج‌شده از کیت QuantiTect Reverse Transcription محصول شرکت کیاژن استفاده شد که در زیر روش انجام آن توضیح داده شده است. تمام مراحل ایجاد cDNA روی یخ انجام شد. طراحی پرایمر و پروب و بررسی کیفیت آن‌ها با استفاده از نرم‌افزار Gene runner صورت گرفت. پرایمرهای اختصاصی برای ژن‌های مدنظر به‌منظور بررسی بیان در سطح RNA در نرم‌افزار Gene runner (نسخه 05/3) طراحی شد. توالی‌ها
شامل
HOXA11-AS-R: CTCAGGGATGGTAGTCCCCA و HOXA11-AS-F: TGGTCAGCAAAACAGACCCA است. پروب‌ها به‌صورت آماده از شرکت Bioneer خریداری شد. توالی پروب شامل CGCAGAGCCTCAGGGACCCT HOXA11-AS-P است. در طراحی پروب های Taqman، انتخاب رنگ مناسب گزارشگر و خاموش‌کننده که برای نشان‌دارکردن پروب استفاده می‌شود مهم است که باید با دستگاه Real-Time PCR استفاده‌شده در آزمایشگاه نیز پشتیبانی شود. برنامه دمایی داده‌شده به دستگاه ترموسیکلر بدین‌صورت بود: 95 درجه سانتی‌گراد به مدت 10 دقیقه، 56 درجه‌ سانتی‌گراد به مدت 20 ثانیه و 60 درجه سانتی‌گراد به مدت 60 ثانیه با 40 سیکل.
 
اطلاعات دموگرافیک جمعیت مطالعه‌شده نشان داد میانگین سن افراد 416/16±70/43 سال بود و بیشترین درصد نمونه‌ها مربوط به درجه 4 بود (جدول 1).
تجزیه‌وتحلیل نتایج حاصل از آزمایش کمّی میزان بیان ژن HOXA11-ASدر بافت‌های توموری نشان داد بین بیان این ژن با درجه بیماری رابطه مستقیم و معناداری مشاهده می‌شود؛ بدین معنا که هرچه درجه بالاتر باشد، میزان بیان نیز افزایش می‌یابد (0002/0P=) (نمودار1).
تجزیه‌وتحلیل آماری داده‌ها به‌صورت توصیفی و تحلیلی با استفاده از نرم‌افزار SPSS نسخه 20 انجام شد. برای مقایسه میزان بیان این ژن در بافت تومورال با درجه پایین‌تر و بافت تومورال با درجه بالاتر از آزمون آماری تی مستقل استفاده شد. سنجش نرمال‌سازی داده‌ها نیز با استفاده از آزمون کولموگوروف اسمیرانف یک‌نمونه‌ای انجام شد (جدول 2).
 
جدول شماره  1: خلاصه‌ای از اطلاعات دموگرافیک و پاتولوژیک نمونه‌ها
ویژگی درصد
سن (سال)  
میانگین سنی 416/16± 70/43
فاصله سنی 75-10
درجه (Grade)  
I 3/5
II 9/31
III 7/11
IV 1/35
غیرقابل تشخیص 16
 
 
 

نمودار شماره 1: تغییر بیان HOXA11-AS ‏در بافت توموری درجه 3 و 4 در مقایسه با بافت حاضر در درجه 1 و 2
 
جدول شماره 2: جدول تفکیکی بیان‌کننده الگوی معنی‌داری ژن HOXA11-AS‏ ‏با به‌کارگیری آزمون تی مستقل
مقادیر محاسبه‌شده مقایسه
درجه 3 و 4 درجه 1 و 2
76/2 Fold Change
tumor in IV and III grade/tumor in I and II grade
0002/0 P***
63/13 t
18 df
بلی آیا با فرض فاصله اطمینان 95 درصد، تفاوت معنی‌دار است؟
 
 
نتایج نشان داد نمونه‌های توموری با درجه سه و چهار، 76/2 برابر نمونه‌های توموری با درجه یک و دو افزایش بیان (fold change) داشتند.
 
بحث
در میان انواع سرطان، تومورهای مغزی جزء کشنده‌ترین سرطان‌ها محسوب می‌شوند. توانایی درمان این تومورها تا حدودی به خصوصیات منحصربه‌فرد سلول‌های ذاتی و ریزمحیطی بافت‌های عصبی مربوط می‌شود (9). تومورهای مغز حاصل رشد غیرعادی سلول‌هاست که ممکن است خوش‌خیم یا بدخیم باشند. در این میان، گلیوبلاستوما مولتی‌فرم شایع‌ترین و درواقع کشنده‌ترین نوع تومور مغزی اولیه در بزرگ‌سالان است. مدت زنده‌ماندن بعد از تشخیص اولیه 12 تا 15 ماه است. این سرطان شیوع نسبتاً کمی دارد، ولی 2/5 درصد از مرگ‌های سرطانی را به خود اختصاص داده است (10).
مطابق دستورالعمل انجمن ملی سرطان (NCI: National Cancer Institute)، بیومارکرها مولکول‌های بیولوژیکی هستند که می‌توانند در خون یا بافت‌های بدن حضور داشته باشند. بیومارکرهای سرطان نشانگرهایی هستند که حاصل ترشح سلول تومورال یا حاصل نکروز و آپوپتوز این سلول‌‌ها هستند. تغییرات اختصاصی مولکول‌های سلول‌‌های سرطانی قابل اندازه‌گیری است. بیومارکرها می‌توانند RNA، DNA، پروتئین و متابولیت باشند (11).
سرطان بیماری پیچیده‌ای است که بیان ژن در آن به‌صورت نامتعادل انجام می‌پذیرد. شواهد نشان داده‌اند بخش زیادی از عوامل مستعدکننده سرطان را نمی‌توان به تغییر در توالی‌های کدکننده پروتئین نسبت داد. شناسایی شمار زیادی از RNAهای بلند غیرکدکننده با طول بیش از 200 جفت باز در انسان‌
که زیرمجموعه‌هایی از
ncRNAs است، کمک شایانی به آشکارسازی جایگاه این مولکول‌ها در آسیب‌شناسی سرطان و نقش آن‌‌ها به‌عنوان اجزای مهم در توموزایی کرده است. نقش RNAهای بلند غیرکدکننده به‌عنوان عامل‌های سرکوبگر تومور، در انواع متعددی از سرطان‌ها به اثبات رسیده است.
مطالعات اخیر نشان می‌دهند چندین جایگاه خطر مؤثر در ایجاد سرطان به RNAهای بلند غیرکدکننده رونویسی می‌شوند و رونوشت‌های حاصل، نقش‌های کلیدی در فرایند تومورزایی ایفا می‌کنند (12). بررسی عملکرد همه آن‌ها در آزمایشگاه مشکل نیست. به همین دلیل در این مطالعه به پیش‌بینی عملکرد RNAهای بلند غیرکدکننده مختلف با یکپارچه‌سازی بیان ژن و بیان RNAهای بلند غیرکدکننده شناخته‌شده جدید پرداخته شده است.
ژن‌های HOX جزء ژن‌های بسیار محافظت‌شده هستند که نقش مهمی در آپوپتوز، سیگنالینگ گیرنده، تمایز، متاستاز و آنژیوژنز دارند. اختلال و تغییرات در بیان این ژن در توسعه غیرطبیعی و بدخیمی مؤثر است و می‌تواند در سرطان‌زایی و حتی سرکوب تومور نقش داشته باشد. ازاین‌رو، شناسایی این ژن در تشخیص و درمان سرطان اهمیت دارد (13). ژن HOXA11-AS یکی از مهم‌ترین RNAهای بلند غیرکدکننده است که عمدتاً به‌عنوان نوعی فاکتور پیش‌آگاهی برای بقای بیمار گلیوما عمل می‌کند. اولین بار Wang و همکاران در سال 2016، یک RNAهای بلند غیرکدکننده جدید را به نام HOXA11-AS معرفی کردند که نوعی رونویسی آنتی‌سنس از HOXA11 بود و بیان آن با زیرتیپ‌های مولکولی گلیوما ارتباط داشت (14). در بررسی ژن HOXA11-AS در مطالعه حاضر با افزایش درجه بیماری بیان HOXA11-AS  افزایش می‌یابد. در مطالعه Wang و همکاران در سال 2016 نتایجی مطابق مطالعه حاضر گزارش شده است. آن‌ها در شناسایی این ژن از روش Microarray استفاده کردند، ولی در مطالعه حاضر از روش RT-PCR استفاده شده است.
در مطالعه‌ای مشابه، Cao و همکاران در سال 2019، سطح بیان HOXA11-AS را در بافت‌های توموری و بافت‌های مجاور آن به روش RT-PCR تشخیص دادند. مشخص شد که میزان بیان HOXA11-AS  در بافت استئوسارکوما بیشتر از بافت‌های مجاور و رده‌‌های سلولی استئوبلاست طبیعی انسان است. سطح بیان بالاتر HOXA11-AS با مرحله بالینی شدید و پیش‌آگاهی ضعف سیستماتیک رابطه مثبت داشت. مهار بیان HOXA11-AS می‌تواند متاستاز و تهاجم خطوط سلولی استئوسارکوما را کاهش دهد (15).
در مطالعه حاضر بیان ژن‌ها در سلول‌های بافت گلیوما بررسی شد. در مطالعه‌ Li و همکاران که در سال 2019 روی سلول‌های سنگ‌فرشی دهان انجام شد، با روش کار RT-PCR نتایج مشابهی گزارش شد. آنان بیان کردند HOXA11-AS به‌طور قابل‌توجهی تکثیر سلولی را افزایش می‌دهد، ولی درصد سلول‌های فاز صفر و یک را کاهش می‌دهد و تهاجم سلول را در OSCC تقویت می‌کند. در یک مدل موشی OSCC، بیان بیش‌ازحد HOXA11-AS باعث رشد تومور شد (16). می‌توان با استناد به این مطالعه، این‌گونه مطرح کرد که بیان ژن HOXA11-AS در تمام سلول‌‌های سرطانی، بدون درنظرگرفتن اندام درگیر با سرطان، موجب افزایش رشد تومور و ورود بیماری به فاز حادتر می‌شود.
در مطالعه‌ای مشابه که Xu و همکاران (2017) در چین روی 45 بافت گلیومای اولیه و رده سلولی با استفاده از روش RT-PCR انجام دادند، مشاهده کردند که حذف ژن HOXA11-AS باعث مهار تکثیر سلولی گلیوما، مهاجرت و تهاجم در شرایط آزمایشگاهی و رشد تومور در داخل بدن می‌شود و هرچقدر بیان این ژن بیشتر باشد، بیماری حادتر و مرگ‌ومیر در بیماران بیشتر است (17). این مطالعه ازنظر نوع بافت نمونه‌گیری‌شده و همچنین روش کار با مطالعه حاضر مشابه است و نتایج به‌دست‌آمده نیز مشابهت دارد.
از سوی دیگر در مطالعه‌ای متاآنالیز که در سال 2018 روی 1320 بیمار سرطانی با انواع مختلف سرطان‌ها انجام شد، ارتباط ژن HOXA11-AS و متاستاز بررسی شد که خاصیت تازه­‌ای از این ژن را مطرح کرد. در مطالعه متاآنالیز مشاهده شد با افزایش بیان ژن HOXA11-AS میزان متاستاز نیز در بیماران سرطانی بیشتر می‌شود که به‌صورت ویژه، بیشترین متاستاز در غدد لنفاوی مطرح شده است (18). می‌توان از این مطالعه نتیجه گرفت که افزایش بیان ژن HOXA11-AS باعث حادترشدن بیماری می‌شود که متقابلاً باعث متاستاز بیشتر می‌شود که با مطالعه حاضر همسو است؛ زیرا ما مشاهده کردیم که افزایش بیان ژن HOXA11-AS در درجه 3 و 4 بیماری بیشتر از درجه 1 و 2 است. به‌طورکلی افزایش بیان ژن HOXA11-AS باعث کاهش سطح رشد تومور می‌شود. ممکن است این تضاد به علت تفاوت در بافت سرطانی بررسی‌شده در دو نمونه باشد. از سوی دیگر این تناقض می‌تواند مؤثر از مکان مطالعاتی باشد که پژوهش Wenlei در شانگهای چین انجام شده است و ازنظر شرایط اپیدمیولوژی و سبک زندگی، دو کشور باهم متفاوت بوده‌اند.
Zhang و همکاران در سال 2017 با دو روش RT-PCR و Microarray روی 220 نمونه گلیوما توانستند متوجه خاصیتی جدید از ژن HOXA11-AS شوند که با حذف HOXA11-AS بیان مارکرهای استرس سرطان در داخل بدن را کاهش می‌دهد (19). بر این اساس می‌توان اظهار کرد که هرچقدر بیان مارکرهای استرس سرطان در داخل بدن کاهش یابد، پیشرفت بیماری کُندتر و سطح رشد تومور کمتر می‌شود. این نتایج با مطالعه حاضر همسو نیست؛ زیرا در مطالعه حاضر ما مشاهده کردیم که افزایش بیان ژن HOXA11-AS در درجه 3 و 4 بیماری بیشتر از درجه 1 و 2 است. ممکن است علت این تناقض در نتایج، تفاوت درجات در نمونه‌های مطالعه‌شده Zhang و همکاران باشد؛ زیرا در میان 220 نمونه، 97 نمونه درجه دو، 34 نمونه درجه سه و 89 نمونه گلیوبلاستوما مولتی‌فرم یا درجه 4 بودند.
 
نتیجه‌گیری
در مطالعه حاضر هدف بررسی ارزش بیومارکری lncRNA HOXA11-AS در تشخیص گلیوما و افتراق درجات کم و زیاد این سرطان بود. نتایج حاضر نشان داد بیان ژن HOXA11-AS افزایش بیان معنی‌داری در درجه 3 و 4 نسبت به درجه 1 و 2 پیدا می‌کند. به‌طورکلی پژوهش حاضر نشان داد بیان ژن HOXA11-ASدر بیماران مبتلابه گلیوبلاستومای درجه 3، در مقایسه با بیماران مبتلابه درجات کمتر، افزایش معنی‌داری داشته است.
 
تشکر و قدردانی
نویسندگان از همکاری صمیمانه متخصصان پاتولوژیست و مغز و اعصاب بیمارستان امام حسین تهران در تهیه نمونه‌های بیوپسی بیماران کمال تشکر را دارند.

 
 
نوع مطالعه: مقاله پژوهشي | موضوع مقاله: علوم پایه
دریافت: 1399/2/25 | پذیرش: 1399/5/1 | انتشار: 1399/5/10

فهرست منابع
1. 1. Malmer B, Henriksson R, Grönberg H. Familial brain tumours-genetics or environment? A nationwide cohort study of cancer risk in spouses and first‐degree relatives of brain tumour patients. Int J Cancer 2003;106(2):260-3. PMID: 12800203 [DOI:10.1002/ijc.11213]
2. Holland EC. Glioblastoma multiforme: the terminator. Proc Natil Acad Sci 2000;97(12):6242-4. PMID: 10841526 [DOI:10.1073/pnas.97.12.6242]
3. Diwanji TP, Engelman A, Snider JW, Mohindra P. Epidemiology, diagnosis, and optimal management of glioma in adolescents and young adults. Adolesc Health Med Ther 2017;8:99-113. PMID: 28989289 [DOI:10.2147/AHMT.S53391]
4. Baskaran S. New molecular approaches to glioblastoma therapy. [Doctoral Dissertation]. Uppsala: Acta Universitatis Upsaliensis; 2017. Link
5. Li Q, Jia H, Li H, Dong C, Wang Y, Zou Z. LncRNA and mRNA expression profiles of glioblastoma multiforme (GBM) reveal the potential roles of lncRNAs in GBM pathogenesis. Tumour Biol 2016;37(11):14537-52. PMID: 27604987 [DOI:10.1007/s13277-016-5299-0]
6. Chen G, Cao Y, Zhang L, Ma H, Shen C, Zhao J. Analysis of long non-coding RNA expression profiles identifies novel lncRNA biomarkers in the tumorigenesis and malignant progression of gliomas. Oncotarget 2017;8(40):67744-53. PMID: 28978068 [DOI:10.18632/oncotarget.18832]
7. Wheeler TM, Leger AJ, Pandey SK, MacLeod AR, Nakamori M, Cheng SH, et al. Targeting nuclear RNA for in vivo correction of myotonic dystrophy. Nature 2012;488(7409):111-5. PMID: 22859208 [DOI:10.1038/nature11362]
8. Seydoux G, Braun RE. Pathway to totipotency: lessons from germ cells. Cell 2006;127(5):891-904. PMID: 17129777 [DOI:10.1016/j.cell.2006.11.016]
9. Aldape K, Brindle KM, Chesler L, Chopra R, Gajjar A, Gilbert MR, et al. Challenges to curing primary brain tumours. Nat Rev Clini Oncol 2019;16(8):509-20. PMID: 30733593 [DOI:10.1038/s41571-019-0177-5]
10. Rahmati S, Emadi Baigi M. Glioblastoma multi form. First National Conference on Biological Sciences, Islamic Azad University, Falavarjan, Iran; 2012. Link
11. Califf RM. Biomarker definitions and their applications. Exp Biol Med (Maywood) 2018;243(3):213-21. PMID: 29405771 [DOI:10.1177/1535370217750088]
12. Noori-Daloii MR, Eshaghkhani Y. lncRNAs roles in cancer occurrence. Med Sci J Islam Azad Univ Tehran Med Branch 2015;25(3):163-82. Link
13. Reardon DA, Wen PY. Therapeutic advances in the treatment of glioblastoma: rationale and potential role of targeted agents. Oncologist 2006;11(2):152-64. PMID: 16476836 [DOI:10.1634/theoncologist.11-2-152]
14. Wang Q, Zhang J, Liu Y, Zhang W, Zhou J, Duan R, et al. A novel cell cycle-associated lncRNA, HOXA11-AS, is transcribed from the 5-prime end of the HOXA transcript and is a biomarker of progression in glioma. Cancer Lett 2016;373(2):251-9. PMID: 26828136 [DOI:10.1016/j.canlet.2016.01.039]
15. Cao K, Fang Y, Wang H, Jiang Z, Guo L, Hu Y. The lncRNA HOXA11-AS regulates Rab3D expression by sponging miR-125a-5p promoting metastasis of osteosarcoma. Cancer Manag Res 2019;11:4505-18. PMID: 31191012 [DOI:10.2147/CMAR.S196025]
16. Li B, Wang W, Miao S, Li G, Lv Y, Xiang C, et al. HOXA11-AS promotes the progression of oral squamous cell carcinoma by targeting the miR-518a-3p/PDK1 axis. Cancer Cell Int 2019;19(1):140. PMID: 31139017 [DOI:10.1186/s12935-019-0838-6]
17. Xu C, He T, Li Z, Liu H, Ding B. Regulation of HOXA11-AS/miR-214-3p/EZH2 axis on the growth, migration and invasion of glioma cells. Biomed Pharmacother 2017;95:1504-13. PMID: 28946213 [DOI:10.1016/j.biopha.2017.08.097]
18. Mu S, Ai L, Fan F, Sun C, Hu Y. Prognostic and clinicopathological significance of long noncoding RNA HOXA11-AS expression in human solid tumors: a meta-analysis. Cancer Cell Int 2018;18:1. PMID: 29308050 [DOI:10.1186/s12935-017-0498-3]
19. Zhang Z, Zhou J, Zhang J, Duan R, Pu P, Han L. Downregulation of lncRNA-HOXA11-AS modulates proliferation and stemness in Glioma cells. Chin Neurosurg J 2017;3(1):1-7. Link [DOI:10.1186/s41016-017-0091-6]

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

ارسال پیام به نویسنده مسئول


بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.

کلیه حقوق این وب سایت متعلق به مجله دانشگاه علوم پزشکی قم می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق
© 2024 CC BY-NC 4.0 | Qom University of Medical Sciences Journal

Designed & Developed by : Yektaweb