دوره 12، شماره 4 - ( تیر 1397 )                   جلد 12 شماره 4 صفحات 30-23 | برگشت به فهرست نسخه ها


XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Fathi M. The Effect of Long-Term Endurance Activity on purβ Gene Expression in Rat Fast and Slow Twitch Skeletal Muscles. Qom Univ Med Sci J 2018; 12 (4) :23-30
URL: http://journal.muq.ac.ir/article-1-876-fa.html
فتحی محمد. تأثیر فعالیت استقامتی بلندمدت بر بیان ژن purβ عضلات اسکلتی تند و کُند انقباض رت. مجله دانشگاه علوم پزشکی قم. 1397; 12 (4) :23-30

URL: http://journal.muq.ac.ir/article-1-876-fa.html


گروه تربیت‌بدنی و علوم ورزشی، دانشکده علوم‌انسانی، دانشگاه لرستان، خرم‌آباد، ایران. ، fathi.m@lu.ac.ir
متن کامل [PDF 589 kb]   (968 دریافت)     |   چکیده (HTML)  (4456 مشاهده)
متن کامل:   (1995 مشاهده)

مقدمه

عضلات اسکلتی از بافت‌های مهم بدن محسوب شده که علاوه بر حرکت، در ساز و کارهای دیگر نیز درگیرند (1)، و براساس تفاوت در میزان و نوع پروتئین‌هایی که در تعیین خصوصیات عملکردی آنها نقش دارند، طبقه‌بندی می‌شوند. ازجمله پروتئین‌هایی که در تعیین عضلات نقش دارند می‌توان به پروتئین زنجیره سنگین (MHC) اشاره کرد که براساس ویژگی این پروتئین، تارهای عضلانی به تارهای اکسیداتیو یا نوع I (دارای سرعت انقباض کند)، تارهای گلیکولیتیک یا نوع IIa (دارای سرعت انقباض سریع) و گلیکولیتیک بی‌هوازی یا نوع IIb (دارای بیشترین سرعت انقباض) تقسیم‌بندی می‌شوند (2). با توجه به ویژگی عضلات، محرک‌های بیرونی و درونی متعددی می‌توانند موجب ایجاد سازگاری در عضلات و در نتیجه تغییر نوع تارها شوند (3). از عوامل تأثیرگذار بر عضلات و نوع تارهای آن می‌توان به فعالیت بدنی، به‌خصوص فعالیت‌های نوع استقامتی اشاره کرد که با ایجاد چالش‌های متابولیکی و جریان‌های کلسیمی موجب سازگاری‌های منحصر به فرد در عضلات می‌شوند (4،5). مطالعات نشان داده‌اند عضلاتی‌که در دراز‌مدت در معرض فعالیت‌های استقامتی قرار می‌گیرند به سمت تارهای کُند انقباض تمایل داشته و این تغییر در کارکرد، مقاومت درمقابل خستگی، افزایش میوگلوبین، افزایش آنزیم‌های هوازی و حتی پتانسیل عمل آنها نیز دیده می‌شود، همچنین در سطح ساختاری بافت عضله، این تغییرات در افزایش میزان تارهای نوع I نمود پیدا می‌کند (8-6). تأثیر فعالیت‌های بدنی بر تغییرات ساختاری و عملکردی عضلات، ازجمله تغییر میوزین زنجیره سنگین تارها از طریق مسیرهای سیگنالینگ متعددی صورت می‌گیرد که در این مسیرها فاکتورهای رونویسی متعددی درگیرند (9)، یکی از این فاکتورها، فاکتور رونویسی پروتئین A متصل به عناصر غنی از پورین بتا (Purβ) می‌باشد (10). مشخص شده است این فاکتور موجب سرکوب بیان MHC نوع I می‌شود و از این طریق شرایطی را مانند بی‌تحرکی عضله ایجاد می‌کند (10،11). معدود مطالعات صورت‌گرفته نشان می‌دهد فاکتور Purβ (Purine-rich element-binding protein B)، واسطه سرکوب بیان ژن MHC نوع I بوده که موجب کاهش بیان آن می‌شود و این عمل را با تعامل بین سایر فاکتورهای رونویسی (Purα، Sp3، عوامل مهم برای تغییر در بیان نوع تارها در پاسخ به بی‌وزنی) انجام می‌دهد (10). مشخص شده است در تجدید ساختار سلولی، فعالیت اتصال به DNA پروتئین‌های Purβ و میزان پروتئین آنها در پاسخ به شرایط بی‌وزنی افزایش می‌یابد، اما در پاسخ به اضافه بار مکانیکی کاهش می‌یابد (10). سطوح Purβ در زمان نارسایی قلبی افزایش یافته و در تنظیم رونویسی αMHC مشارکت می‌کنند (10). با بررسی مطالعات انجام‌شده مشخص گردید هنوز هیچ پژوهشی در مورد تغییرات ژنی و یا پروتئینی این فاکتور رونویسی به فعالیت‌های استقامتی صورت نگرفته است. با توجه به نقش فعالیت‌های استقامتی بر MHC نوع I، همچنین تأثیر Purβ بر این ایزوفرم، این پژوهش با هدف بررسی تأثیر فعالیت استقامتی بلندمدت بر بیان ژن Purβ عضلات اسکلتی تند و کند انقباض انجام شد.

روش بررسی

در این مطالعه تجربی، از 20 سر رت صحرایی نر نژاد ویستار (با 5 هفته سن و وزن20±113گرم) تهیه‌شده از انستیتو پاستور استفاده شد. رت‌ها تا رسیدن به سن بلوغ در شرایط استاندارد (دسترسی آزاد به آب و غذا مخصوص رت، چرخه روشنایی و تاریکی 12:12 ساعت، میانگین دما 3±22 درجه سانتیگراد) نگهداری شدند. در ادامه، بعد از رسیدن میانگین وزن رت‌ها به 24±231 گرم، یک دوره آشناسازی (10 روزه در 5 جلسه) با تمرینات استقامتی (دویدن روی تردمیل) برای آنها در نظر گرفته شد. در پایان جلسات آشناسازی، حیوانات به‌طور تصادفی به 2 گروه شاهد و تمرینی (هرکدام 10 سر) تقسیم شدند. از رت‌های گروه تمرینی، 3 سر نتوانست پروتکل را به پایان برساند؛ بنابراین همراه با سه سر از رت‌های گروه کنترل (به طور تصادفی) از روند پژوهش حذف شدند.
یک برنامه فعالیت استقامتی ویژه رت با استفاده از مطالعات قبلی برای گروه تجربی طراحی شد (12،13) که این پروتکل (شامل 14 هفته، هفته‌ای 6 روز) به‌صورت
دویدن روی تردمیل با سرعت، شیب و زمان قابل‌برنامه‌ریزی‌شده بود. هر جلسه با یک بخش 5 دقیقه‌ای با سرعت 12 متر در دقیقه برای گرم‌کردن شروع ‌شد. در جلسه اول، بخش اصلی پروتکل 12 دقیقه بود. به‌طور هفتگی مدت زمان بخش اصلی پروتکل (در هفته یکم تا سوم هر روز 2 دقیقه) افزایش ‌یافت؛ به‌طوری‌که در پایان روز بیست و سوم مدت بخش اصلی پروتکل به 50 دقیقه رسید که با احتساب 5 دقیقه گرم‌‌کردن و 5 دقیقه سرد‌کردن، مدت زمان کلی، 60 دقیقه در نظر گرفته شد. شدت تمرین با سرعت 20 متر در دقیقه شروع شد، سپس هر هفته 2 متر بر دقیقه به سرعت اضافه گردید؛ به‌طوری‌که در پایان هفته ششم سرعت به 30 متر در دقیقه ‌رسید. در نهایت، در طی هفته‌های هفتم تا دهم به‌تدریج 5 درجه شیب (ابتدای هر هفته تقریباً 2/1 درجه شیب) نیز اضافه شد. این پروتکل {60 دقیقه دویدن (شامل 5 دقیقه گرم‌کردن با سرعت 12 متر در دقیقه، 50 دقیقه دویدن با سرعت 30 متر در دقیقه، با شیب 5 درجه، به‌عنوان بخش اصلی پروتکل و در نهایت، 5 دقیقه دویدن با سرعت 9 متر در دقیقه به‌عنوان بخش سرد‌کردن)}تا پایان هفته چهاردهم حفظ شد. پروتکل بین ساعات 7-6 بعد ازظهر هر روز اعمال ‌گردید. در نهایت، 48 ساعت پس از پایان آخرین جلسه تمرینی، رت‌ها با ترکیبی از کتامین (50 میلی‌گرم به‌ازای هرکیلوگرم) و زایلازین (5 میلی‌گرم به‌ازای هر کیلوگرم) بیهوش شدند؛ به‌طوری‌که به تحریک اعمال‌شده پاسخ ندهند. در ضمن، همه نکات اخلاقی نگهداری و کار با حیوانات در طی آزمایش رعایت گردید. در ادامه، عضلات نعلی و EDL آنها تحت شرایط استریل خارج و همه آنها در دمای 80- درجه سانتیگراد نگهداری شدند.
برای استخراج RNA همانند مطالعه قبلی عمل شد (14) و برای رونویسی RNA به cDNA، از کیت شرکت Scientific Thermo Cat # K1621 استفاده گردید. تمام مراحل مطابق دستورالعمل شرکت‌ سازنده انجام گرفت. ترموسایکلر مورد استفاده در این مرحله متعلق به شرکت Eppendorff بود.
قبل از ارزیابی نهایی بیان ژن، طبق دستورالعمل روشPCR  Real Time لازم بود میزان کارآیی ژن رفرنس (Housekeeping) و هدف (Purβ) بررسی گردد. میزان کارایی برای این دو ژن در بالاترین میزان خود (یعنی یک) بود. در ادامه برای ارزیابی بیان ژن، از روش Real Time PCR و دستگاه شرکت آپلاید بایوسیستم (Applied Biosystem) استفاده شد. سایبرگرین مسترمیکس (SYBR green master mix) استفاده‌شده در این مرحله متعلق به شرکت تاکارا#RR820L Cat بود. طبق دستورالعمل کیت و بررسی میزان کارایی ژن رفرنس و هدف، برای یک نمونه 10 میکرولیتری، ترکیبی از مسترمیکس (5 میکرولیتر) پرایمر (1 میکرولیتر)، cDNA (1 میکرولیتر) و آب مقطر (3 میکرولیتر) در نظر گرفته شد و میزان بیان ژن با استفاده از روش نسبی ارزیابی شد. در هر Run (40 سیکلی)، یک نمونه به‌عنوان کنترل منفی برای تعیین آلودگی Master Mix در نظر گرفته شد و کنترل داخلی (gapdh)، کنترل مثبت (گروه کنترل) و Purβ همزمان (در یک Run) ارزیابی شد. نمونه‌ها به‌صورت دوتایی بررسی شدند. بعد از به دست آوردن CT دوتایی برای هر نمونه، میانگین آنها محاسبه گردید، سپس با استفاده از نرم‌افزار Excel، طبق فرمول: ctΔΔ2-
میزان بیان ژن  Purβ تعیین شد (15).
مشخصات پرایمرهای استفاده‌شده در جدول آمده است.
ژن رفرنس مطابق تحقیقات انجام‌شده (16)، ژن gapdh (Glyceraldehyde 3-Phosphate Dehydrogenase) در نظر گرفته شد.
 
جدول: مشخصات پرایمرهای مورد استفاده در پژوهش
Product size NCBI Reference Sequence Sequence 5-3   name
74 NM_017008.4 AACCCATCACCATCTTCCAG F gapdh
CACGACATACTCAGCACCAG R
100 NM_001017503.1 GTGAGGAAGTGGATGAGGATTG F Purβ
GGACGAGTAGGAAAGGGAAC R
 
داده‌های به‌دست‌آمده از دستگاه Real Time PCR که به‌صورت (Cycle threshold) CT (میانگین CT برای هر نمونه) بودند (19-17)، با استفاده از نرم‌افزار Excel به ctΔΔ تبدیل شدند، سپس با استفاده از فرمول ctΔΔ2-:
اعداد نهایی به دست آمد (20).
داده‌ها با استفاده از نرم‌افزارSPSS  نسخه 20، آزمون شاپیرو - ویلک (جهت نرمال‌بودن توزیع داده‌ها) و آزمون تی (برای تعیین اختلاف میانگین‌ها) تحلیل شدند.
 
یافته‌ها
در این مطالعه، در اثر 14 هفته تمرین استقامتی، میزان بیان ژن purβ در عضله تند انقباض (EDL)، به‌طور معنی‌داری کاهش یافت (006/0p=) (نمودار شماره 1)، اما میزان بیان این ژن در عضله کُند انقباض (نعلی)، به‌طور معنی‌داری (0001/0p=) افزایش یافت (نمودار شماره 2).

نمودار شماره 1: میانگین تغییرات بیان ژن purβ عضله EDL گروه کنترل و تجربی در اثر 14 هفته فعالیت استقامتی.
ØØ=معنی داری در سطح 01/0 p≤.
 
 
 

نمودار شماره 2: میانگین تغییرات بیان ژن purβ عضله نعلی گروه کنترل و تجربی در اثر 14 هفته فعالیت استقامتی.
 ØØ=معنی‌داری در سطح 01/0 p≤

بحث

نتایج این تحقیق نشان داد میزان بیان ژن purβ در اثر فعالیت استقامتی در عضلات اسکلتی تند و کُند انقباض تحت تأثیر قرار می‌گیرد؛ بدین صورت که برخلاف عضله EDL که در آن میزان بیان این ژن در اثر یک دوره فعالیت استقامتی به کمتر از نصف کاهش می‌یابد، میزان بیان این ژن در عضله نعلی در اثر فعالیت استقامتی تا حدود 15 برابر افزایش پیدا می‌کند. باید اشاره کرد هنوز پژوهشی در زمینه بررسی تأثیر فعالیت بدنی بر بیان ژن purβ انجام نشده است؛ بنابراین نتیجه این پژوهش با توجه به مطالعاتی بررسی گردید که عمدتاً به شناسایی و ارزیابی سایر جنبه‌های این ژن پرداخته بودند.
فعالیت بدنی موجب تغییر در بیان ایزوفرم‌هایMHC  در عضلات اسکلتی تند و کُند انقباض می‌شود که این تغییر با تغییرات فعالیت ATPase ایزوفرم پروتئین MHC همراه است (21). از طرف دیگر، مشخص شده است miRs بر فرآیندهای سلولی تأثیر زیادی دارد (22). اخیراً نیز مطالعات نشان داده‌اند بسیاری از تغییرات ایجادشده در تارهای عضلات اسکلتی به این عناصر ارتباط دارد (23)، این عناصر از طریق سرکوب بیان ژن به‌صورت آبشاری موجب تغییر در افزایش یا کاهش ژن‌های هدف خود می‌شوند (26-24). یکی از اهداف miRsها ژن purβ است؛ بدین معنی که این ژن توسط miR-499 سرکوب می‌شود (27)، و در ناحیه غیرترجمه‌ای َ3 mRNA ژن purβ دارای یک جایگاه اتصالی برای miR-499 بوده که بیان این ژن، به‌وسیله miR-499 مهار می‌‌گردد (27). احتمالاً دلیل افزایش بیان این ژن در عضله نعلی ناشی از کاهش بیان miR-499 در این عضله است. علاوه بر نقش miRsها، پژوهش‌ها نشان داده‌اند تعامل بین Purβ، Purα و Sp3 در تغییر بیان نوع تارها در پاسخ به بی‌وزنی، نقش تعیین‌کننده‌ای دارند. فعالیت اتصال به DNA پروتئین Purβ و میزان پروتئین آنها در پاسخ به شرایط بی‌وزنی در تجدید ساختار سلولی افزایش می‌یابد، اما در پاسخ به بارکاری کاهش دارد (10). ji و همکاران در مطالعه خود عنوان کردند احتمالاً‌ کاهش بیان ژن Purβ در عضله EDL ناشی از پاسخ این فاکتور به افزایش بارکاری عضله بوده است (10). McCarthy نیز گزارش کرد در طی آتروفی عضلات نعلی، بیان miR-499 و miR-208b به ترتیب 40% و 60% کاهش می‌یابد که این کاهش با افزایش 23% ژن Purβ همراه است (28). در مطالعه حاضر، آتروفی موجب افزایش بیان Purβ در عضله نعلی شد و انتظار می‌رفت فعالیت استقامتی تأثیر معکوسی بر بیان این ژن در عضله نعلی داشته باشد که برخلاف انتظار، این یافته با نتایج McCarthy (با ایجاد آتروفی) همخوانی داشت. در این پژوهش میزان بیان پروتئین Purb که در حقیقت واحد عملکردی بیان ژن و میزان آن تعیین‌کننده تأثیر نهایی فعالیت استقامتی بر بافت بود، ارزیابی نشد؛ بنابراین پیشنهاد می‌گردد پژوهشی در زمینه ارزیابی میزان بیان پروتئین این ژن در طی یک دوره فعالیت استقامتی انجام گیرد.
 
نتیجه‌گیری
نتایج این پژوهش نشان داد باوجود همسانی، میزان و شدت فعالیت استقامتی بیان ژن purβ در تارهای تند و کُند انقباض متفاوت است که احتمالاً در مسیر سیگنالینگ بالادست این ژن که بیان آن را کنترل می‌کند، پاسخ به فعالیت استقامتی متفاوت باشد.

 
References:
 
  1. Stannard SR, Buckley AJ, Edge JA, Thompson MW. Adaptations to skeletal muscle with endurance exercise training in the acutely fed versus overnight-fasted state. Sports Nutr Rev J 2010;13(4):465-9. PubMed
 
  1. Scott W, Stevens J, Binder-Macleod SA. Human skeletal muscle fiber type classifications. Phys Therap 2001;81(11):1810-6. Link
 
  1. Harridge SD. Plasticity of human skeletal muscle: Gene expression to in vivo function. Exp Physiol 2007;92(5):783-97. PubMed
 
  1. Adhihetty PJ, Irrcher I, Joseph AM, Ljubicic V, Hood DA. Plasticity of skeletal muscle mitochondria in response to contractile activity. Exp Physiol 2003;88(1):99-107. PubMed
 
  1. Holzer N, Ziltener JL, Menetrey J. Plasticity of striated skeletal muscle: Training effect and perspectives. Rev Med Suisse 2006;2(74):1798-804. Link
 
  1. Schantz PG. Plasticity of human skeletal muscle with special reference to effects of physical training on enzyme levels of the NADH shuttles and phenotypic expression of slow and fast myofibrillar proteins. Acta Physiol Scand Suppl 1986;558:1-62. PubMed
 
  1. Hoppeler H, Fluck M. Plasticity of skeletal muscle mitochondria: structure and function. Med Sci Sports Exerc 2003;35(1):95-104. PubMed
 
  1. Baldwin KM, Haddad F. Skeletal muscle plasticity: Cellular and molecular responses to altered physical activity paradigms. Am J Phys Med Rehabil 2002;81(11 Suppl):S40-51. PubMed
 
  1. Fathi M, Rahmani Nia F, Moradpoorian MR, Asgari M, Rezaee R. The relationship between maximum aerobic power and coronary heart disease risk factors. World J Sport Sci 2009;2(1):1-6. Link
 
  1. Ji J, Tsika GL, Rindt H, Schreiber KL, McCarthy JJ, Kelm RJ, et al. Puralpha and Purbeta collaborate with Sp3 to negatively regulate beta-myosin heavy chain gene expression during skeletal muscle inactivity. Mol Cell Biol 2007;27(4):1531-43. PubMed
 
  1. Kelm Jr RJ, Wang SX, Polikandriotis JA, Strauch AR. Structure/function analysis of mouse purβ, a single-stranded DNA-binding repressor of vascular smooth muscle α-actin gene transcription. J Biol Chem 2003;278(40):38749-57. PubMed
 
  1. Jin H, Yang R, Li W, Lu H, Ryan AM, Ogasawara AK, et al. Effects of exercise training on cardiac function, gene expression, and apoptosis in rats. Am J Physiol Heart Circ Physiol 2000;279(6):2994-3002. PubMed
 
  1. Sun L, Shen W, Liu Z, Guan S, Liu J, Ding S. Endurance exercise causes mitochondrial and oxidative stress in rat liver: effects of a combination of mitochondrial targeting nutrients Life Sci 2010;86(1-2):39-44. PubMed
 
  1. Fathi M, Abroun S. The effect of endurance activity on left ventricle Purβ Gene expressionin wistar male rat. J Ilam Univ Med Sci 2016;23(6):74-84. Link
 
  1. Tang H, Macpherson P, Marvin M, Meadows E, Klein WH, Yang XJ, et al. A histone deacetylase 4/myogenin positive feedback loop coordinates denervation-dependent gene induction and suppression. Mol Biol Cell 2009;20(4):1120-31. PubMed
 
  1. Silver N, Cotroneo E, Proctor G, Osailan S, Paterson KL, Carpenter GH. Selection of housekeeping genes for gene expression studies in the adult rat submandibular gland under normal, inflamed, atrophic and regenerative states. BMC Mol Biol 2008;9:64. Link
 
  1. Yuan JS, Reed A, Chen F, Stewart CN, Jr. Statistical analysis of real-time PCR data. BMC Bioinformatics 2006;7:85. Link
 
18. Wong ML, Medrano JF. Real-time PCR for mRNA quantitation. Biotechniques 2005;39(1):75-85. PubMed
 
19. Gunning P, O’neill G, Hardeman E. Tropomyosin-based regulation of the actin cytoskeleton in time and space. Physiol Rev 2008;88(1):1-35. PubMed
 
20. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29(9):45. PubMed
 
21. Baldwin KM, Haddad F. Effects of different activity and inactivity paradigms on myosin heavy chain gene expression in striated muscle. J Appl Physiol 2001;90(1):345-57. PubMed
 
22. Fathi M, Gharakhanluo R, Solimani M, Rajabi H, Rezai R. The study of timing series response of microRNA-1 expression to resistance exercise in slow and fast muscles of Wistar male rats. J Sport Biomotor Sci 2013;9(1):5-15. [Full Text in Persian] Link
 
23. van Rooij E, Liu N, Olson EN. MicroRNAs flex their muscles. Trends Genet 2008;24(4):159-66. PubMed
 
24. Callis TE, Chen JF, Wang DZ. MicroRNAs in skeletal and cardiac muscle development. DNA Cell Biol 2007;26(4):219-25. PubMed
 
25. Zacharewicz E, Lamon S, Russell AP. MicroRNAs in skeletal muscle and their regulation with exercise, ageing, and disease. Front Physiol 2013;4:266. PubMed
 
26. Guller I, Russell AP. MicroRNAs in skeletal muscle: Their role and regulation in development, disease and function. J Physiol 2010;588(Pt 21):4075-87. PubMed
 
27. van Rooij E, Sutherland LB, Qi X, Richardson JA, Hill J, Olson EN. Control of stress-dependent cardiac growth and gene expression by a microRNA. Science 2007;316(5824):575-9. PubMed
 
28. McCarthy JJ, Esser KA, Peterson CA, Dupont-Versteegden EE. Evidence of MyomiR network regulation of beta-myosin heavy chain gene expression during skeletal muscle atrophy. Physiol Genomics 2009;39(3):219-26. PubMed
 
 
 
نوع مطالعه: مقاله پژوهشي | موضوع مقاله: سلولی و مولکولی
دریافت: 1395/3/8 | پذیرش: 1395/10/12 | انتشار: 1397/3/25

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

ارسال پیام به نویسنده مسئول


بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.

کلیه حقوق این وب سایت متعلق به مجله دانشگاه علوم پزشکی قم می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق
© 2024 CC BY-NC 4.0 | Qom University of Medical Sciences Journal

Designed & Developed by : Yektaweb